Description :
From Genome Similarity Track
Location :
Scaffold_1777:1610- 3983
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1777-snap-gene-0.3Pleckstriny domain-containing protein
Pytiw_DAOMBR242034maker-piw_contig_1777-fgenesh-gene-0.1Insulin-degrading-like enzyme, metalloprotease family M16A

Sequence
2373 bases(100 bases per row)
GACGTTCATGAGGTAGAGGAAGACCTCCGAGGGCGTGCCGTCGACCACGCGCAGGTTCTTGAAGCTCGGCACGTGGCCGCGCACGCGGTGCGCTGTCATG
GTCCAGAGCGCGCCCAGGACGACGAGGAGCGCGAGCAGCATGGCCGTGAGGACGCCGCCACCGCCGATGCTCCCCGCGAGGAACGCCACGAGCCCCGCGG
ACGCCGTCGAGAGCAGCATACCGTTGAGCGGCTCGCTCAGGGACTCACCGGTCTGCCACAGCCCGTACAAGACGACAAATAAAACCATCCAGTGAGCAAT
CTAGTGAGCACAACAGGGACGATGCAATACAGAAAGCGAATGAACAATGTACCTGCTGCTGGTAGACCTGCAGGCCGCCAAAGAGGTCCACGACCGTCCA
CGTCGCGGAGAACATGGCCCAGGACCGCTCGAGCTCGCTCAGCAGCTTCATCGTGCTCGGTAGGTCCGCATTGCCGTTGTTGATACCAACAGCAGCAGCA
GCAGTAGCTCCTCCTCCTGCTAGGGTCACACCAGCAGCTCCAGTCGCAGGAGCAGCGCCGGGCGCCATCGCTTTCGCTGTTCCGCTCGCGAGGCCGCGGG
GAGACGAGTGGCCGCGTCGCAGCAGCGCGTCCTGCTGCGCCTTCTCCACGTGGGGGCGGTCGAGATGCGACGTGTTGCGCCGTGTGGAACTGAGCTGCTC
GTCGCCGCTGCCGTGCGAGGGCTCCGTCATGATTCAAGAGGAATGCAAGCATGACCGTGGGAGCAAGGAAAGGGAGGGCAAGTGTACCGATTTGAATGGT
ACACTTTGGGACATGTGATCCACGTGTGTTGATGGCAAGATTTGGACCTCCTGGGGGGACTATTACAACCTTGTCGTCATCGTTCTCATCATGGCTCACT
CTTCAACAACACTTTGCACCTCTATTGAAAAAAAGTAGCGACACGACTCAGTATGCAATGCAACCGCCAACCTTGATACTGTTGCTGTATGTCCATGCGC
CCAGGAATGCTGGCTTTCTCTTCGCGATGTCTCATTTACAAGCGAGCTGTCGTCGATGCAGCGGTCGCAAGGCCGTCGCGCGATCGCTCCGGGAACAGCG
GCATGCGGCGCTTGAAGTCGTCGATGTCGCGAATGATCTGCAGCGATGGCATAGACTGATCGCTGCCCTTGAGCTCCATCGACGCACTCACACCAGTGAC
CGCAGCGAAGCTCAGAGCAGAGAGGTCGCTGTTGCCAGCACCACCGGTGGTAGCAAGCTCGGGGAACGCGTGGGCTGAGCCGTAAAGCTGGACGCTCAGC
TTGCTACGCTTGCTGCCGTCCACCGCAATGTACGTGTCGAAGAACTCGAGCAGGTCGTTCTTGCAGAGCGTAGCCACACACGCCGCGACCCGCTGGCGAC
GGTCGAACACGTACGTCTCGTTGGCGATCTCGCGCCAGAAGCGCATACACTCCTCGGACTCTCGCTTGGGTTTCTCTATCAGCGCCTTTATGACTGCGTT
GACCTGCTTCTGCCAGAATCCAGGCTCCATAGTCACAAGCAGATCGCGGAAGCTTTCGACGAAGAGCTCCACGCGCTGGTTCAGATACGCCGGCGACGCG
ACGTTCGACTGCAGCAGGATGCGAAAGTACTCGATGCCTTCCGTGCGCATGATACCCGAGAAGACGAGGTACCCGAGCTGCTCCTGCGTGCGCAGCTGGT
TGAAACACGGCTCCTTGAAGATGTGCGCGAAGAGCTCGATGCGCGCGCGCAATTCCATGGATTCCTCCTGGATCTGGTACAACGAGCAGATGGACGAGTT
GAGGTTGTCCGCGTTCCACTCCTTGCGTTGGTACAAGTACTCGCTGGCGTCCTCAAGCTGCACGATGCGCGACTTAGTCGCCTGGCTCGGCAGGACCGGA
AAACTACCGCGTGTAGTGCCGAACCGAAACTCCTTCACCACGCGCTGCATCAATGGCGACGCAGCACTGCGCGCCATGTTGCCGTAGAAGAAACCCTCGA
CAAAGACCTGCTGGAACAAGAGCTGGGCGTACATGGACAAATCGCGGATCGTCAGGCGCTGGATCGCCTGGACCTTATCCTCGACGCTCCACTTGGCCGA
CTCGAGCAGCAGGCTTGAGCCGTATACCGCGTGCTGGTACGGCTCTTCAAGGAAGAAGTTCTCATACATGCGCTTGGTGCGGTCCTTGACGCGCTCGAAG
ATCGCTTCCTGGAACTTGTACGTGTCCTTCGTCATGTTCATCATCGCGTGCAGTACCTTGAAGAGCAGCGTCGAGAGCTTGTGAGAAAAGCCGCCCACGT
ACATCTCGATCGCGCGCGCATTGAACGAAATCTCGTACTCCATGCCGGCGAGCTCGGCGTCGTACGAGCACTC