Description :
From Genome Similarity Track
Location :
Scaffold_2598:161- 1367
Sequence
1206 bases(100 bases per row)
ACAAGACGACGATGAAACAGTTCTGCTACCGTGAAGGGCGGGAGATTTACACCCGGAGGTTTCTGGAGAGGATAGGGCGGTAATTCTCGTGCTGGAGCTA
CCACTGCCCACAGAGGAGGTCACGATTGATGATATCCAAGTGGATCCAGGGGCGAACGAACCCACTGAAGTGGATCGTCTGCGTCAGAAGATCTGGGAAA
GCCGACATCTGCTGATCGGTAAGGGTAATGCGTTACCGCCCGCCGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAAAG
GGTGCGGAAGGTGGCACCTCAGTTCCGAGAAAAACTGTCGGATCTGATTAAGGGCCTGCTGCAAGCCAGGATCATCAGCTTCTCAAAATCCCCGTGGGCG
TCGCCGGTGGTAATCATCATCAAGAAGAAACGGGGGTGGATATACGTCTGTGCATTGATTACCCGGCTGGTTAACAGCCTGACTCGATTGATGGTGTATC
CGATGCCTCTGATCAAATGAGCTGTTGGAAGATTTGGATAAAGCACTCTGGTACTGTTCTCTAGACATGGCCAGTGGTTTCTGGGTGGTTACTATGACGG
ATCGAGCTCGCGCAATATCCGCATTCATCACACCGTTTGGCCTGTTCGAGTGGACCCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACG
CCTCATCGATAACGCCCTCTATGGGTTCACCCGAATACCGGAGCCCGAAACGGGTGGATCCGGGGAAGGTGACGCAGAAGTGGATCCATTCGAAGCGGGG
GAGCCAGGGGATCCTGGGACCCCGTCTGTGTTAGGACGCAGATCTTACATCGACGACATTCTGATCCCGGCGGAATCGTGGGATCAGTTGTGCGAAAGAG
TGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTTAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTGGGCCATCGAGT
TTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCTTCATTAGCCGATTTGTCCTTCCCACAGTCGTTACGAGCGATGCAATCCTTCTTGGGCAGT
TTGAACTACTACAGTCGGTTCATCGAAGATTACGCCTTGTTTGCCGCGGTGTTGTATGAATTAAGAGAGGTAGATTTTGCTGCGATGACCGCTCCAGCTG
TCCGGA