Description :
From Genome Similarity Track
Location :
Scaffold_25:161- 1274
Sequence
1113 bases(100 bases per row)
CCACTCAAAACGCGGGCAACTTTCTGGTCTTCGTTGGAGGTATTGAAAACGTAAGCAAACGCCTTGTTTGTTGCTGTCATGTTCCAGCTGCCGCGGTCAA
AGATCCATTGCGGCGACAACTCCGACAATCCGTTCGCTAACTGGGCTCCTCCTCGGTGGAAGGAATGGGATGTCAAATCAGCTAAGACTCCAGCTGGTTG
GCAGATGCGGTTCAGCAGGCGGTTGATGTGACTGTGGACTCCGGGAAGAGCTGCAACTGACACTTTCATTGTAGCCGCTGCATCCATGGGCTGCATCCCG
ACGACCGCTCCAAGTGGTTCGTTGAGCAAGTCAATTAAGGGGATCGACGACATCGCTTCTGCTTGTACTGCCGCCTCAACGGATGGTAAGTTACCAAGGA
GGGCGGCATGTGGCGTCGATTGCATCACCACAGCAGCAGCCATTGCGGTAAGGGGACAGCCAAGGAATTTCTCATCGTAATACAACGACAAACCTTGTTC
ATCTGATGTCTTCATTCGCATCAATCGCACAATTAGTACGCCGGCAGCGCTGACCGTTAGGTTTGCCTTCTGGAGTGACGACAGGTCCGACGCACGGCCA
AATAGGTACCATAACAAGCACAACAGAGCGGCATCCTGGTAGTCGGTAGCGTTCTTTGCGGTTGAGTACTGGTAGCCCATGAGAGTACGGAGGTGGTCCT
TAGTGCACGCTGGGGCCTTCTTGATAAACCCGCCCGAGTTGCGTTTCATGCAGTACCGGTCGAGGGTTGAGCCCATTTTCAACAGCTTGGCGGAGACGGC
GGCGCTAAGTTGGTAGAGTTCAATCAGCCACAACTTGACGTGGCGGTAGTACGACATGACTGTGTTCCGAGCGATCTGTTTCCCACCCTTGGTGTCGAGG
AATGCCAAGTACGACCCAAACTTGTCAAGCACACGTTCAATGGCAACGCCAGTAGGGTCAAGAGCAAATTGTGCATGAATGTATTCCATTGTTACATTCT
CTTCTGTGACAAAGCGCGTAAACGACTTGATCGCTGTAGCATTCGCCTTGGTCGTGTTGGCAGGCACAAGATCTTGAATCCCCATGCAGAATGATATGCC
AAAGTGATTGCTA