Description :
From Genome Similarity Track
Location :
Scaffold_3821:161- 1271
Sequence
1110 bases(100 bases per row)
AAGCACATCCTGATACACGACATTCTGGACACACACGTGGTCGTCTTCTTCATGGACGTTGTGATCGATTAGAATCTTGATGTTGGCTTTTGAGGTGACC
CGGGAGAGCGCAACGTAGAGCTGACCATGCGAGAAGGCTGGTTGTGGGAGGTACACACCCAAATGGTGGACAGACCGGCCTTGAGACTTGTTGATCGTCA
TTGCAAACGACACTTGGATCGGAAACTGACGTCGGCGAAGCTGGAATGGGAGAACCATCTCGTTTGTTGTCAGCGGGATCCGAGGAATGGCAACTCGCTT
CTGAGCAAACGCTCCTGTAAGAATTTCTGCGATGATGCAATTACGGAGGAGCTGTCGAATTTGAAGACGTGTCCCGTTGCACAATCCTTGCGCACCATTG
ATATTCCGAAGGAGCATGATTGGAGTCCCGATCTTGAGCTGAAGTTTGTGCGGCGGCATCCCTGAGACAGTGAGCGTGTTGAGAAACTCTACCGGATACA
GGTTGCTCTGACGCTCGTCTCTCTCCTCGACCGAATCAAGCGACAGGTACTCTGATGTCTCCCCCGGTAGTGACTCAAGCACGCCTTGGTTGATTGCTTG
GACATCCACGTTGATCGGAGTTAGGATTGCTCGACTGGAAAAATACCCGGGCTCCAAGTACCGCTCTTGAATGTCGCCATAGATATGCTGGATTAATCCA
CTAACCGAACTTTGACCATCCTGAGCTTCGACAATCATCGAACGGGGAATCTTGGCGTGGCTCTTTCCTTGTTCCGAGCAGCAATCGTGTCTGCCTTCTC
CAATGCGCAACAGGAACTCTGCGAATTCTTGAATCTCGGTAGCGTCTCCCACGGTCGGGGCGTTTTGAACACGCATGTTTGTGCTAATCTGGAGCGTCTT
GAAGTGACTCCAGAGTCGGGACTTCTTCACACAGGCAGATACGATCTCACCGGCCGTCGCGCGCGGAACCACTGGAAGTATTTGCCGGAAGTCGCCAGCC
AGCAACAGCACTTTTCCTCCGAAAGGTTCTTCACATTCATGCAACGACTTCAAAGTCCGGTCCAAAGCCTCGAACGCATATCTGTGCGTCATCGGAGCTT
CATCCCACAC