Description :
From Genome Similarity Track
Location :
Scaffold_1474:161- 1170
Sequence
1009 bases(100 bases per row)
GCGTACGACAGGTtcATGGCCTCTGGACCTGATCTTGTCGTCTCGCAGGACGaTAAGATGCCGAATGgAGtGcctgcTTGCGgCTAAAACCCTCCTCCAT
CGCAACTACGATCGCCTCGTCGAGTTTTtCACACTTGACGTGAAaGAGATGCGTCTTGATCGGACCATCTTCAAGCCCcTTGATAAaCGTAATGACcTGA
GTTTGTGGGTCGATGGGgTTCGCCACGGTACAGCTCACGAGGTATCGGgCGTGCTgagCGTAAGCATGAACATCATGCATACCCTGCTTCAAGtccAGGA
ACTCGGCGCGAGCCCTGAACTCCGCGTGAGGAGGCTCGAaCGTCTATTGGAGCCTGGTCTTGAATTCCTTTAACGGTCCAAAACAATATGGATCGTGAaa
gTTGAGACCCAAgCCcAAGCCTTGGCGCGTCCAGCCAGATTGGACACGGAGAAGGTTACCTTCATCGcACCGTCCTCAGTGCGACGAGCTCGATGGTATC
ATCGAGCTCAACGAACCAGCGCAAGGCGATTTCGCTCTCAGCGGCCTTGTATTTGGAGATCTCgATCTCCAAGGCTTGACACGTCTCGTGCAAGCTGTGG
TAGCTGCAGCAACGGACTGCTGCTGCTGTCTCAaCAATTCTATCaGTTGAGCGCCTTGCAGATCGGCCTGCTGAGCTGCTTGCTGTTGAAGCGAAGCGAG
GGAACCTCTCGCTTCGTCCAATTCATGTTGAATGAACTGGGCGATACTATCGTgTTGCTCATCAtGCGAGAGCGATAtgAGCATGACACCTACGGCAGCG
TCGCCGATGGTCCTGGCCATGTGTTGCACCGCCTGCCACTCAAGGTCGCCCTAGTGGAGGAAGTTCTCACGCGAAGCGTGATGattttGCAGACCTGTGG
TTTCCGACACAGGAGTGTTCATAGTCGTTGGACGGACTACAAAGCGCTACCAGGTGTAACGAGATGACTCATTACTTCACTTACACCGTGAGCAGTGTAG
GAAGtGTAG