Description :
From Genome Similarity Track
Location :
Scaffold_156:16096- 18706
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_156-fgenesh-gene-0.1P-type ATPase (P-ATPase) Superfamily

Sequence
2610 bases(100 bases per row)
CAACGCCGTGTGCACGTCGCGCTACACGTGGTGGGACTTCGCGCCGCGCTTCGTCTTCGAGTCCTTCTCCAAGACGGCCAACCTCTACTTCCTCATGGTC
GGCGCCTTCCAGGCCGTGCCGTCCATCTCGCCCACGGGCGGCGTGCCCACGCAGCTCTTCCCGCTCGCCGCCGTCGTCATCATCGACGCCGTCTTCGCGG
CGCTCGAAGACCTCCGCCGCCACCGCGACGACACGCGCGCCAACGCCACGACCACGCACGTGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCTCGACGGCGAGAGCAACCTCAAGCGCCGCGACGCGCCCAAGCCCACGCGCCAGCTCTTTGTGGCC
GACCACCAAGTGCCCAGCGGCTACGTCGACGCGGAGCTGCCCAACGCCGACGTGCACCAGTTCTCGGGGACGCTCCACCTGCCCCACCACGCGCCCGTGC
CGCTGTCGATCCAGAACGTGCTGCTGCGCGGCACCAAGCTGCGCAACGCCGACGCGGCGTACGTGCTCGTCGTGACCACGGGCGCCGACTGCAAGGTGCT
GCGCGGCAACAGCAGCAGCGACGCCGACGCCAAGGTCTCGTCGCTCGACGTGCTCGTGAACCGCCAGGTGCAGATCGTCGTCGTGCTGCTCACGATCGTG
TGCGTGGTCGGCGCCGCGACCGACAACTCGTCGCTCGCCGACCTCAAGTTTGCCGCCGCGTTCGTGGCGCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNGCTCTTCGAGTCGCTCGCTTACTACCTCTCGCTGCTCTGTGACCTCGTGCCCATCACGCTCTACGTGACCATCACGATCGTGCGCGCGTTCCA
GTCGTTCTTCATGGCCCACGATCTCGCGCTGTACGACGCCGCGAGTGACGCGCCGCTCGTGGTACGCAGCATGCAGCTCAACGAGACGCTCGGGCAGATC
ACGCACGTCTTTGCCGACAAGACGGGCACGCTCACGTGCAACGACATGGTGCTGCGCAAGTGCACGATCGGCGGGACCACGTACGAGACGCTGCGAGGCC
TGGGAGAGTCGTCCCGAGCCTTCTTTACGCACATGGCGCTGTGCCACTCGGTGCTGATCGAGCACCGCGAGGAGGGAGACGAAGAGATCGAGTACTCGGC
AGCGTCGCCCGATGAGCAGGCGCTCGTGTGCGGCGCACGCGACCACGGCGGTGTGGCGTTCGTGGCGAGAGNNNNNNNNNNGCCGAGTCGCTGACGCTGC
GAGTGGCCGACTTTGTCGAAGTGTACGACGTGCTCGAGGTGCTCGAGTTTACGTCGTCGCGCAAGCGCATGACCGTCGTGGTCCAGAAGCACCGCACCGC
CGAGAACGAGGGAGAGAAGAAGGACGACGTGCTCGTGCTCACCAAGGGCTCGGACAGCGTGCTGTTCCAGCGGCTGGCCAAGTCGGATGAGAACGCCCGC
GTGCGCGACGCCACGCAGTCGCAACTCACGGCGTTTGCCCACGACGGACTGCGCACGCTCGTGTTTGCGAGCAAGCGGCTGTCCCGNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCGCGTTCCACGCGCGGTACATGCGCGCACGTTCGGACCTGCGTCAGGTCGAAGCGCAGGCGCAGGGTCTCGCCAACGACATTGAC
ACGCTCCAGGACGAACTTGAGAACGGACTCGAGCTGCTGGGCGCGACGGCGATTGAGGACCGTCTCCAGGACGGCGTGCCCGTGACGATCGCCAAGCTGC
GCACCGCGGGCGTCGCAGTGTGGATGCTCACGGGCGACATGCAGGAGACCGCCGTCAACGTCGCGCGCGCGTGTCACTTGGTGGACGACCANNNNNNNNN
NCACATGGAAGACGAAGACCGCGAGTCCATCTTACGGCAGCTCGATGACGTCTTCCACACCATGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCGGCCGGACGACCACCACGCCATCGTCATCGACGGCGCGAGCCTTCTCTCGGTACTGCGCGAGGAGA
CGGAGCAATCTGCAGCGGAAACTGGTGACGATGATGACAGCGAGCAGCGCCTCGTGCGCGTGGCGCTGCACTGCCGAGCGGTCATCGCGTGCCGCGTGTC
GCCGCTGCAAAAGGCGCAGCTCGTCGGGCTCGTCAAACGCCACGTCCCCGACTCGCACACGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNCCGATGCTGCGCGTGGCCCACGTTGGCGTGGGCATCGCCGGCCAGGAAGGCCGCCAGGCCGTCAACAGCTCCGACTATGCGATC
GCACAGTTCCGGTTCCTGCAGCCGCTGCTGCTGGTCCNNNNNNNNNNNNNGGAACTATGACCGCGTCGCCGGGCTCGTGGGCTATACGTTCTACAAGAAC
ATTGTCTACA