Description :
From Genome Similarity Track
Location :
contig_65:160939- 162156
Transcript NameFunction/comments
g9531.t1serine protease family S10, putative

Sequence
1217 bases(100 bases per row)
GGACGAGACCTTCTGCGACTCGACCAAGCAGCTCAGCGGCTACTTCAAGATCTCCGGGTCCAAGTCCAAGAACTACTTCTACTGGTTCTTCGAGTCGCGC
GGTTCGCCGTCCACGGACCCCGTGGTCATCTGGCTCACTGGCGGCCCGGGCTGCAGCTCCATCTTGGCCTTACTGCAGGAGAACGGGCCGTGCTCCGTTA
ACGACGATCTGTCACTCAAGAGAAACCCCTACTCGTGGAATGAAAGAGCCAACGTCATGTGGATCGATCAGCCCGTCGGTGTGGGCTTCAGCTACGGAGA
CGTGAGTGAGTATGACACGTCGGAGAAAGAGGTGGGGGACGATATGTTCCACTTCCTGCAGGAGTTCTTCCAGGCTAAATCAGAGTACCAAAAGCAACCT
TTTTACGTGTTCGGGGAGAGCCGGGCACTATGTGCCGGCCATCTCTCACCGAATCTTCACTGGTAACCAGCAGAAAGAGGGACCCGTGCATATTAACTTG
CAGGGGTTCGGCATCGGCAACGGGCTAACAGACCCCGAAGTGCAGTACAAGTACTACCCGACATGGCCTACAACAACACGTACGGAGTCAAGGCCGTGTC
GTATCCCGTGTATTTGGCGATGAAGGCGGCGGTGAGTCCCTGTGTGGGCATGATTTCCGCCTGCCAGACGAGCAAGGCGGCGTGCCTGGCGGCGCAGACG
TTCTGCAATGCTGCGTTAGTGGCGCCGTACACGGCGTCCGGGTTGAACGTCTACGACATTCGATCCAAGTGTGCACACCCTCGATGTGTTATTCTTTTGA
AAATGTGGAAAAGTTCCTGAGGCTCGAGAACACGCTGAAGAAGCTGCACGTGAGTCCCAAGAGCGCTAAGTGGCAGAGCTGCAACATGGAAGTCCACGCC
GGATTTTCGTTCGACTGGATGAAGAACTTCCAGCAGTTGGTGCCGCCGATGCTCGAGGCCGGCATCCGAGGTCTGGTCTACGCTGGGGCGCTGACTTTAT
CGTAAACTGGATGGGATGCAAGGCCTGGACGCTGGAGCTGCCGTGGAGCAAGCACGAAGAGTTTCTAGCTGCTAAAGACAAGGAGTGGGTCGTGGACGGC
AAGAAGGCGGGCCGACTGCGCCAGGTCGGACCATTCTCGTTTCAGCAAGTGTACGAGGCCGGTCACATGGTGCCTCTCGATCAGCCCAAGAACGCGCTAG
CGCTGCTCAAGGCCTTC