Description :
From Genome Similarity Track
Location :
Scaffold_183:16093- 24874
Transcript NameFunction/comments
g13704.t1POM79948.1 Reverse transcriptase, partial [Phytophthora palmivora var. palmivora
g13705.t1hypothetical protein

Sequence
8781 bases(100 bases per row)
TTTTCGTTGGTCTTTTTCACATTCATTTTTGGAACTTCCGAGAATGCTAGCTTGCTAGGTTTTCTTGGAACGGTCTCCGGGGGCTTTCACTATCTCCCCC
GCGAGGCCAACCACCACACTTCTTTTTCTTTGTTCATATATTTCAAATTATACTTCGCCACTTGGTGCCTCCACTTTATTAGGTATATACAAGGCTCTTG
TAAACCAAGCATTTTGCTTAGTTTTGTGAAATTCGATCGATCAAATGTCATATTTTAGATTGCGTTTGCCAATAATAGGAATTGCGGTCAAATGATGAAT
AGTCACAATAGAATGTTACGTTAAACATGTATTTTCGAAATAATCACGCTGTGGGTAGCAGACTAGAACCATGTATATCTGCATGTGTTACACTTTTGTA
TCGAATGTACACAATTCAACGTATAATACCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTAATCAGTGTGAAAACTGGTTTCCGACGTT
TTTCGTTGGTCTTTTTCACATTCATTTTTGGGCATCCCGTTGTCGTGCAGCTTGCTGTGCGAGGACGGGGCGGTTTCCGGGGGCTTTCACCTTTCCCCCG
CGAGGCCAACTACATTTGACTCTTTTCTATCTTCCTTTCCTCCTCGGCTGTCCACCTCGGTTCGCGTTGCGTCCTCTGTTGTCCCTTTACCCTTTTTGAC
CAATAGGATCGCAGCGATGCGGTTCTTTTGGCCAATCAGAGAGCGCGCTACGTCCACCGACAGCGAGTGCTCCACAGCCAGCCAATCCAGTCTCGCCAGC
GACGCGTCTTTTTACAGCGCGGTCGGTGACGAGAGTGGGCTGGTCGGTGGCGCAGTGGACGGGTGGGCGGATCCACTAGGGGTGCGGTTACACACTGTGG
ATCCGCTCGCCCCGTTTTGGCCCTTTCCGGGCCGGAAATGGGGCCCGGAGAGCCTCCACGCGCGGTGCCGCTGCTCGGCACCGGCGACGCTTCAGCGGCT
GCAACTTCGGGCACGGGTCCGGGACCCGCAGCGCCCATTGCACCGCGACCCCTCACGCGCCTCGAGGCCGCTGCCGGCGAAGAGACGCCCCGCCCCGCCT
CCACGACATCGCGTCGTTTCGGGGATCCACCGGCGGATCCACCGTCCGCTGGTGACAGTGGACGGCCCGATGGTGCGGGCGGGAGGTCGGCGCACCCCTC
CCCACTCAACCCCACTATGGGTCAAATGCTGGCCTCTCAGGCCGTACGGGCGACGCTTCCACAAACGGAGCTTCTCAGTTCGTACGGCCGGCCGGCGAAG
AAGCGCCGCCGAGCGCCGGCCGCTGTGACGGCCCCAGACATCCGCCGGTCCCCCACGCGCGTCCGTTGGCTGGCCAAGGTCCCTCGCCCGCCTCTTCGCC
CGCGCCCAGCTTCCCCCCCCCCCCCCCCCCCCGCTGCCTAGGGAGGTGATTGCAGCCCGCGTCGTGGCTCGACTTGGCGAGCACCCTGCGCCCCGCTGGG
GCCCACCACTACCACGCCGCATGGTGGTATCTCAGATCGCCGACCGGTTGCTCCCGCCGGACTTGGCGATCGATGAGGAGACCAAGGACAGCAAGGAATC
GCGGGACAACGAGGAACCCAAGGACAGCGAGGCGGGTGGGGCCACTAGCGAGGACACGGACGGAGAGTGGCTTCTACGCTTCGACGGCGCCTGTCGGGCC
AGCCCTGGCCCAGGCGGTGCTGGAGCCGCCCTCTTCAAACCCAGCGGCCCGGTGGTGTGGACTTGCTCCCACTATATGCCCAGTAGCAGTGAGACCAACA
ACACGGCAGAGTACACCGCACTGCTGCTCGGGGCCCGGGCCGCCACTGACCATGGAGCCACGCGACTGCGAGTGGAAGGCGACAGCGCTCTGGTCATCCA
GCAGGTGCGCGGGATCTTCGCAACAAGCAGCACCAGGTTACGCACGCTGCGAAAGGCAAAGCGGAGCTAACCAGGCTGGAGGCCTTCTCACTCTACCACA
TCGATCGCCAAGCGAACGGACACGCTGACCGCCTTGCCAACGCCGCGCTGGATCGTCGCAAAACGAGCATGGGGTGTGGAGTGCACCCAGATAGCCAAGG
ATGCACGAACACATCGGTCGAGACCACCCGAACCAGCTCAGCCGCCTCCGCCGCTACCACCAGCTGCATCGGCCGACGCAGATATGCTCGACCCAGATGA
GGATGCTCTTGCAGACATTGACGATGGCGAGGTGTACGCAGCCATGGCCGTCGACCCGGAAGCAGTGCCGCAGCGCCGACCCCGCATAAGCCTACGAGAG
CTGACTGAAGAGGAGCAGGAGACGGCGGCCGCGATCGTGGAAAGGCTCAGCGCGACGCTGGCAGCCAAGATCACCGATGCAAGCGACTGGGAGTCGGCGG
AGGGCTACATCACAGCCCTCCCTTATCTACTCTACGACAAATTGTTGCCGTACTCCCAGGGGCCAGCCCGCTCCTTGCTGGTCCGCCAGCCACAGCAGCA
GCAGCAGCCGGACGGACAGTACCAGCGACCCACTCAGTCCCGGCCTGCGGCTCGTCGACAGCGACGCCAGCGCCACCGGGCACGTCGCCGACCGCCACGC
GTGACTCGTCACCACCGTGAACACCGACTAGACGAAGCGCTTGACGACCTCCACGCGGTGGAGAGAGCTACGCCCAGCGACCGCCGATCTATTCACCGAG
CCCGCCGTCGGGTCGGCCGCATTAATGCGGCCGTCGAACAGCAACGGCTCCGGCACCAATTCGATACGAACGAGAAGGCCTGCGTGGAGATCCTACTGGC
CAAGGCGCGTACACAGAGATCGACGACGGTGGCCCGGACGGCAGTTGGAGCGCCGGACAGCGGTGCGGCCGAGGACGACGGCACGTGCCCCATCCCGAGC
GAGCGCCTTCACCGCCACTTCACCGAGGTGAACACGCCCGGGTCCAGCTTTGATGCGATGGGCCCCGTGGGTGCATCGTTCCGTGCGGCACTTGCGCACC
TTCCCGCGGCCACAGAGGCCTCGGAGCTGCTGACAGAGACGCCCGATGAGATCGAGGACCAGCTGCAGCGAGCCAAGGGAATGACCAGCCCTGGCCTGGA
CGGAGTGGACTACGACATCTACAAGGCCTTCGCCACCCAGTTACTGTCGGTGCTGCACGCGGCATTCCAGTGCTGCTGGCAGCACCACCGTGTGCTGCAG
AGCAGGAAGCAAGGCATCGTGAGGCTCCTGTACAAAAAGGGCCCGCGCGAAGACCCCGCGAACTGGAGACCTATCTGCCTCCAGCAAGTGATCTACAAGA
CCTACGCCGGGGTCCTCGCGCGGAGGTTTACGCGCTGGTTGGCTGCAAACGGCCGCCATGCCGACGCCCAGAAGGGGTTCCGCACTGTAAATGGCTGCGG
TGAGCACAATTTTCTCGCGTCGACGCTGATCGATCATGCGCGCCGCAGCCGCAGAGAGCTCCACATGGTCTGGTACGACCTGAAGAACGCCTTCGGCAGC
GTGCCCCAGGAGTTGCTGTGGGAGGTGCTGCAGCGCATGGGTGTCCCGCCAGCCTTTGTGGAGGTCTGCCAGGGGCTGTACCAGGATGCTGCCTTCACCG
TCGGCAACGCTGCTGACGGCCCGACCGATCTCGTGCGGCAGCTCGTGGGCGTGTTTCAAGGATGCCCGCTGAGCCCCCACCTGTTCACTGCGGCGATCAG
CCCGCTCCTCCACGCGCGGGAGCGACTCAAGGACACGGGCGTGCAGCTGTCAGCGGACGACCGTCCCGGTGCCTCGGCCTACGCCGACGACCTCAAGATC
TTCAGCGGCACCGCGGACGGCGTTAAGCGACAGCACGCGCTCGTGGCCGACTTCCTGCCATGGTGGCGAACCCGACCAAGTGCAGCACCATGTCGATCCA
GCGCGACCACCGCGGCGTGCTGAAGGCCTGCGACCTGGAGCTGCAGCTGGACGGAGCCCGGATCCCCTCGCTGACCATGAACGCGTCGTACGCGTACCTG
GGGATCGGCAACGGCTTTGACCACGTGCGCCGCCGCATCGAGCTCGTCCCGGCGCTCACGCAGCTCAAGGACGATGCGACGGCACTGCTCCAGTCGGGGC
TGGCGCCGTGTCAGGTGGTGAAGGCGGTGAAGACTTACCTCTTCCCGCGGGTGGAGTACGCACTCCGCCACCTCCGCCCCTTTCAGCAGCAACTGGAAGG
CTTTGATCGCCACCTCGTTTGCGGCCTTCGCCACCTGCTCCGACTTCCGGTCAACGCCACGACCAGTTTCTTCTTCGCGCCGGTGTCGCGCGGCGGGCTA
GGCCTGTTGCCACTGACGGAGCTGCACGCAGCTCCGACTGATCGCCGACCGGCGCCACCGCCTAGACCCCGACCACTGGAAGGAGCGGGAGGAGAAAATA
TGCGAGCTGCGGATCAACTCGCAGCTCGGGACGTCGGCCCACGCCCCACCCAAGCGCCGCAACGGCGACATCGGCTCGTTGTGGGTCGACGTCCAGCGCC
ACCTCCGAGGACTCGGCCTCAAGCTAGAGACCGCGCCGGCGTGCGTGGAGACCGGCACCGCGGAGGCGACGCTGCAGCTTCGCGTGCCGCACCATGAGAA
GTGGCTGGACCACCGTACGGTCCTGCGGCAGGTGAAGCTGCACATGAAGAACAAGCATTGGCAGCGGTGGGCCGCGATGAAGGACCAAGGTAAGACCGCC
CGCACCCATGGAGGTGCAGGGAGCGGCTTCCTCACGCGGCCTCGCGGCCTATGGGAGACTGACTACCGCTTTGCAGTGGCGGGTCGGCTCAACCAGCTGG
ACACGCACAGCGTGCTGAAGTGCCGGCGCCTCCGCGCGCACGACCAGTGTCGACAGACGGGCTGCTCCAGGGCGGAGACACTGGCACACGTGCTCAACGA
GGGAGTACTGTTTACACCAAAATTTGTCCACAAAACACCAAAAGTGTACCACCCGCACCCTTGAAAATCAGCTGGCATCGACCGATACCTAATAGCCACC
CGATATTGGGGTGATAACACCGCAATATGGCGACCTGCACTATAGCCCTGAGACCACACCAGACAATATAATTTTGACCAATCCATGGGTGCCCCCTCCA
CCTGAATTACAACCAGTAATTTACTGGAGGTGGGTCGCCTCCCTTCTCCACGATCATTTAGCAACCCCCCCCCCCCAAGTCCTCCATGGTTTTCCGTCAC
CCTTGGCAGCTACTCGCGTCTGCAATGCCGCAAATTGAGGCCGACGGCCTGTTGGATGGCTTCAAGAAGTTCCGAGTGAAGAAGAGCGATGTTACCAGTG
CTACATATGCATGCACCCCGATCCGCATCCGATGCGAGTGCAACGTTTAACCTGCGCGTGCAAGGCGTGCACGAACGTGACGACCACTTCAGCATGCCCA
TGGAGAGCTCGAGTCATGACGTGTCAATGACGTGTCAGAAGAAACTTTTGGTAACGATTGAGGAGGCATACGCCCATGCTACCCCAGCTCGCACCCCTCG
CAAACCTGTGTTGACTCGAGCGATGAAGACAGTAGTTATGGATTGGTCTGCTCAAGGCCTCAAGCCCAAACGCATTTGGAACGCACTTGTCCAGCGCTTC
AACCTGAACGAGACCTCGGCACCAACTCTCGCCACAGTGCAGCGCTTTGCGCATCACCACGTTGCGGGGAGGCTTGGCGGTAGCGACCTCCGCGAAACCG
TACGCAACAAGGTTCAATAAACCTTTTTCACTGGCCAGGAGGAAGAGTCTGCAGCGTTCACGTTCACAAAGCATACAGATGCGAACGGAAATCCTGTAAT
TGGCAACGGTAGTGACGCTGATCCCTTTGTCGTCGGAGTCAGCGCTAAAAAACTTCTGCGTCGCGCGGATCGGGATCCTACGTCGTTTGTTCTTCACGTC
GACGCCACCTACAAGCTCACCCAAGTAGGCTACCCCGTCATCGTCGTAGGAATTTCGGATCGCGCAAGGCGCTTCCATCTCTTAGCGGTGTTCATTGTTT
CACAGCAGCAGCAAGACCAGCACACTGAAGTCCTCCAGTTACTTCGCCAAGTGTTTAGTGATGTGGTGGGCAAGCCTCTCAAGGTTCGTTACGTGATGGG
TGATGCAGACGCAGCCCAATGGAACGCTGTTGAAGAAGTGTTCGGAGGGGACTGTGCGTACATTTACCTTATGTGCTACGTTCATGTGGCCAAGAAGATT
TTTGAGAAAACGCGGTCCATGGCGTGCAACCTTGCAGAATCTGTAATGGCAGACATCCATGACCTGCATTTCACGACAAGTGACGCAGCCTTCCACGATA
AGCTTGCTCTGGTGCAAGAAAGATGGGCCAAAAACAAGGACCTCGCAGCTTTCTCAAAGTATTTTTCCAAGGTATGGCTGAGCCAACGCTTTTGGCGATG
GCAGTACCCAGCGGTTACGCAACCACCAACAATCCTTGTGAGACATACAACGCTGCAATTAAAAGAGACATCACGTTGCGCCGCAAGATGAAGATAGGTG
CTCTCATCCCACTGATTCGGACCCTATGTGGAGGGAAAGTGTGGCGGCCAAGACGTTTACAGCCACCTGTGAGCCTGAAGCCAGACTTGTGCGTCAGAGC
GATGGCTCGGGCAGATTTACTGTCGGTGCATTCTACCTCAAGAACAAACATCCAATTCATACTGTCAGACGATTCTGAGGACCCGTCGTGTGACGTTGTT
CGTGTTTTGAGTCGTCCCTCTCCTCGTGTTTATGACGAGACAAGGCGCAAGACGGTAGAAGATCTACCCATCTCCTCGCAGTTGAATAAGCTTACAGCTA
ACATGGAGACACGGGGAATGCCTGCGTCGGGCTGGCCTGTAGATATGCAATCCAGGTCGTGTCCTTGCAATTTCTGGAACAAGTACGGATCTTGCATCCA
CATGCTGTATGCATTGGAGCGTCACGGCGCTACGGACATTCTAGGAAGAGAGACGCTTGTAAACCGCGGCGCAAAAGCGCGCAGAGGTGCAGTTGGGAGT
GCTGGTCGACCGCGCAACATTGGCCAGGCGCTAGAGAGAGAGTAGGGATGACTATGTGTGCAAAGATTAAAAATATGAAGTAATGTGTCCTCACTTGGCT
ATCCGACTTGTTCGTTGTTGGTGATAGAGAGCGACATGTTAGTGGTTATTTGTTCTATACAATTTGTTCGCTAGTGTATGTACTAGTGTAAATGACGCAC
AAGAACTTCAATCGTTCGACCCTTCCAAATAGGCTGCGATTTGAAAATATTTATTTGTCAGACAATATCCCCTACCTGTGATGCCTACTGCATTTTCGTC
TGTAGAAAATAATCTATGCGGATAGAAATGAAAGCCACTAGCTTCAAATACCCTCGTCAGTCTTATTCAGGATCAGGGCTGCGCTTGAAAAGTATCTTCA
AAGTTGAAGTTGAAAATAACTTCAACTGTACTACACGGAGCAGTCAATTTTACCGTTTAGTCTAATATGGTTTGTACAAATGACGTGGTAGAGTCTAACA
ATTGTCATGATTAGCTGTTTGTGCCGCAGTCACCACTAGATTAAAATAGACTGCGAAAAGAAAATAGCCGAACATATTTTTACGGTACCGAGAGTTAACC
CAAGTACTGCTTTCATCCAAAATCGGTGTTGAGCAAAATCACCAGTGCTAAGAGACAAATCAGAAGCACCAACGTAGTTACTACATTACTAGTTATTTAA
AAATGCTGCGAACACAAATTAAGCCGGACGCAACAAATGTATTAATCCTCCGAGTCTCCTAGGTTTCCTCTCTTAGCGGCTCGCACCCTCCTTCATCTTG
CGTTTCTTGTCCCTTTTCGCGCTTGTTCCCACCCGCGCTTTCTCAGACTTCTCAAACTATTCCAGCTTTGCCATGAACTTCTTCTTCTCCTCTTCGAAAT
ATTCCGGGGCGTAGTCGCCTTCCTCCATCATGCTATAGGCCGAAAGCAGGGATTCCCAGGCTTTTCTTGATCCCTTCTTAGCACCGGATGCCACCTTGGT
AGCGTACCTAAACGACGCGCATCGGTCCTTCTCGCGCACCACGATATCTCCGAAGACCCCACCCCACTTGTTGGTTTCCGGTGTGCCCGGCTTGTAGACC
AAAAGGACCGAGTGGAAAACGAGATTGTTTAGGACTACGACGTCGCCAGGACGCTGCACCAAAACGCCGCTGCCTGTGGCCTGCAGCATGCGGTTGATTG
AGTCGTCCTTGTAACCGTAGTTGAACACGGTTCGCTTCTCAGATTCCGGGGGGAAGAAAACCCATACCTTGAAACAATCCTTGGCGCAGGCCACTCACCT
GTGTGCCAGGCCCAATGGTGTCCTCTCTCCCTTCCCACACCGCCGTTTGCATGAATCGGACTCAAATACATCATGCTGGTGTCGAGGTTGGAGTCGGCGT
GGCTTGGCCACGACTTGGTCTCCACCTCCTTGGCAAGTTGCTATCGTTGCCCAGAGTCGCTCTGCTGGCATCGAACGCGACAGGACACTGCACGGGCCTG
GTCCACGTGACTGGATGAGTGGGGGACTCGAGCGGATGGACTGGTGTCGTGCGGCCTGTGCGTTAGCTGTGAAGGCACGGAAGCATTGAACGGATGCGTA
CGTGATGGGACAAGGCTGCGGTAGTGCACAGCGTTGGTGGTGGTGCGTGTGGTGCGCGCAAAAGGAGTTGTCTAAATGGAAGAGGGGTAGGTAGGCTTCG
ACGCGCGGGTAGCTCAGTGGTAGAGCGTTCGATTGCAGCTCGAAGGGTCACTGGTTCAATCCCGGTCCCGCGCTTCTTCTT