Description :
From Genome Similarity Track
Location :
Scaffold_151:16092- 17180
Transcript NameFunction/comments
g10140.t1KUF91188.1 Plasma membrane ATPase [Phytophthora nicotianae

Sequence
1088 bases(100 bases per row)
AGTCCACTCCCGGGGGTGCGCCTGGTTGAAGAACGAAGTGTCCAGGATGCTCGTCGGCATTCCCAGCTGACGGCACGTCTCCACAGCAATGGACTTCTGG
TCACCCGTGACCATCTTCACCGCGATGACCAGCGCAATGGCCTTCTTCACCGTGTCAGCCGTGTCGTGGCGAGGCAGGTCGAACAGCGGCAGCAGACCGA
TCATCTGCCACTCGCACTCCTTCACGGGCACGTCGCCGCTGCGAGCGATACCCACACCCAGACCACGGTAGCCGCGTGACACGAACTTGTTGATGCGGTC
CTCCACCTCCACGCGCATGGCGTCCGCGTTCACGACCATGGCCAGCACCACCTGCAGGTCGTTCTTCACGGCACGGAAGATCTCGCCCGTCTTGTTGTCC
TTGAGCTTGGCGATCGTGCGCTTCGTCGTCGGTGTAGTGCAGCAGCGTGTACTCATCCCACATCGTGTCCTACAAGTTGTGGCACACAATGTCGATGGCC
TCGTTGTTCTCCGTACGGGCCGACAGCGCGCCGCACTTGAGGATGTCGTCCGCGGTGAAATTGTTGTACGGGATTAGGTTGTCCATGTCGGTGGTCCGAG
CACAGCATCTGCATGTTGTCCATCACCTCACTGCACGCGTCATGATGGCGTTCTCCTTTGCAATCGCCGACGAATCGATGACCAGCGTCACGAACAGCAC
TGTCGGCATGGCCACGGGTATATCGTCCACGATTATCACCAAGATTTTGGCCATGCCCAGGAAGCCGTCCGCCTCAACCACGCACAGTTTTTGCGAGGTG
CGGCTGGTCATCTGCACCACCAGCTCCACCACGCACCAGAACAGGATCGTCACTATGCAGAAGTTGCCCAACGTGGTCAGTATCGGCCTGCAAGCTTGGT
ATCGCTATGGACATTTGCAAGTACGAGTTTAATACGACGTCAGCCGTTGTTTTGAAGAGTACTCTTACACCTCTTCCTTTTGTTCTTCATACAGCGTAGC
ACTCGAAACAAAGTTTGCCATCATGTCATCCATGATACTGTCCATATCCGTATAAATGTCGGGGTCTGCATCAAGCGGGAAGGTGAAA