Description :
From Genome Similarity Track
Location :
Scaffold_16:16091- 20155
Sequence
4064 bases(100 bases per row)
GATGGCCTCGACTTCATATTCGCCGGCAACTTGATCTGGTTCCCAGCTGTCTTCAGGCAGTAGTTCCTCATCGAAGTCGAGTCTTGCTTCATTAGTCGCG
TCTAGTACCAACCGAGTGTTCGGTCGACTGCTGAACTCGTTGACAGCCTTGAGTCTCGACACATGCACTACTGGGTAGAAGCGATACCCACTTCGGTCAG
GCAGTTCCAGCTCGTACGCAAACTCTTCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCATCGGTGAGCTAATTTCTTCGTCAAGCCCGGTTTGACGCG
TTCCATGTACAACCACGCCCGGCTCCCAATCTCAAAAAGAGATCTCGGTGAAGCTCTTGCAGGATCTTCCATCTCTCCTGAAGCTTCTAGGGGGTCCGCC
GAGTGTTCGTTTCCACTTGGTTGGGGTACAGCAGCTTTTTCCAGTCGACTCAGAGCATCATTATGATTTTTTGCCCTTCGCTCCTTTTCTACAGCCTGAT
AATCTTTGGCCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCACGCCGCCACGCCAGTGCGTCAGACTGCTTGCCGAGTCCTCGTTTGAGTGATGA
CGACATTGCCCGCAACGTCGACAGCGCATCCCAACCATGAACGAGGTAAAACGGCGTTTCCTTCCTCGTAGTGTCTTGAGAAGTATTAATAGCAAATACT
AGCTTCTCCGCGATTTCGTCCCAATCTTGCTGTAGAGGGTCTTCCGCGTACACCCGTACGGACCCCATCACTGACTTCACCGAGCGTTCCTGCTGTCCAT
TAGGCTGTGGCCTATAGCTCAAAGTCGCTCTTGATCTTGACTGCATCATCTCTGCAAATGCTTGGAAAACCTCGCTCATGAAGCGTGGGTCGCGGTCATG
CCGTATTAATGATGGGGCTCCGAACCGTCGGTACACACATTCTTCGAACACTTGGGCAACACTCAGTGCAGTCGTATCTGACATAGCCTTGGCAATAACG
AATCCCGTGAACGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCGGAAGTGGGATCACAAAATCCATCGAGACGATCTGGAAAGGTC
GTTCGGCTAGTACGTTGCCAGGTGAGTATCCACGAAGCTGCGGACGGCTTTTACTCGAGCTGCAATCTGGACATGACTTCACATGCTTCTCTACGTCAGC
GTACAAGCCGATCCAATAATAATCGGACTTAACGCGATGGAACGTTCTCACCACACCTTGATGTCTTCCTTCCAGCGAGTCGTGACAGTTCTGCAAGACC
TCTTGAATCATCGTTGTCGGTACCACAAGCCGCAGCTTGGTCTCCTCTTGCCAACCGTGGTGGTACCGACGATTCAATCCAAGATAGTGAAGCACGCCGT
CTTCTGATAACACGAACCGGTCAGCGTATTTCCAGGCATTTCGAGCTTCTTTGTAACTCAGCTCTTGTGCTTGGCCCTAAAGCACCTTCTTGATGTTAAA
CCACTTCTGCTCCTCGTCTTGTGCCACCAGTATCCGTCTGCGTCGTTTCCGCTGTATCGCTACTGGGTCAACATCTTCCGCAATGGGAAATGCCGCTGAT
ACAGTCTTGTGAGGATGGTCTGGCAAATCTTCGCCGAATGAATCTTCGGTGGACGTCTCTCGTCGTTCTTCATTCTGTTCTTGAGCTTTTGAGACATCCT
CCGAGTGTTCATCTGCAAACCTGACTCGTTTCCTGGCTTTCGTCTGTCGCCGAGTCATCACTGCTATATTACCATAATCGCACTTTGGTGAGCTGTAATC
AACCACGAAATTTTCGAAAGTTTTCCACTTTGAAGACTCGCTGCCTGACAGTACATGTACTTGACGCTCTGCTCCTCGTGATGAAACATTTACCGAGTCT
TCATCCGGCTCGTAGATCATTTCCTGGATGCGGTTCAGCGATGCCAATTCCGACTTGCGAGTTTCAGCCAAGATTACCCGACTGACCTTCGATTCCAGCG
CTTTAGTGGCTAACGAATCCGCGGCCGCGTTGTATTCTCGTACAACGTGAAGATATTTAACTGATCGAAGCTTGGCCGTGAGTTCCTTGTGAGTATTCAG
CAGCGCTAGCAAAGTTTCCTTCCTGCATGCGATCACCCCTAGTGATTGTTGAATCGCGAGCCTTGAGTCACCAACGATGACTAAATCCTCGGCACCGTGC
GCAATAGCAGCCTTGACGCCGTTGATCATACCTTTATACTCTGCCTCATTCACCGTGGTAGCCGAGAGGTAAACGTTTGCAGCAATCACTACCTTCCACT
CAGGAAGGCTCCACAGCACCCATGAACAACTCCCGTAGCCACCGTACTTCTCTGTCTTCGCTGATCCGTCAAACGACATGACGAATCCGCTGTAATTACG
GGAAAGCCTGGCGTACAGCAACGCGGGGTCCATTCGAATAGTCGGGGAACCCTTGTTTGGAGGCGCCACCGGCGCGAGCGAGTCTTCCAGGTCAACGAAG
CTCGTGATGCTTGACTGCAGTAGCTGCGCAAAGGCGACATCCTTCTCCTTCACGCGCTGCACCTTAAGGTGCCACTGCGATAGCAGCACTGCGAACTGGA
CCGCGCGTCCGAAGAGAGACTTCGACTTATGCACCCACTCTAACGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGACGTAACAGAT
CTTCAACAGCAGAAGTAACGCCAAAACCTCCTTCTCAGCAGGATGATAGTTCATCTCGGCCTTTTTGAGCACCCGACCGAGGAACCGTACGGGGTGAAAC
TTGCCTTCATGTTCTTGCATTAGCGTAGTGCTCAACGTCCATTCATTCGCAAAGAGCATGACGTGAACTTCTTTCGACCGATCGAAGTGCCTGAGGATGG
GTGAATGTGAAACACTCATCTTCAATCTCTCGAAGGAATGACGTGCCACAGAAAGGCCACCTTCAACGAGAAAGTTTTCATCCTTGAGCTGGTACAGCGC
CGCACCATAGACCGCGAAGTCTTGAATGAAGCGGCTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTACTCGTTGGAAACGAAAGCTCG
GTGATAGCCGCAAGCTTCTTGGGGTCAGCTCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGTTGGCAGAAGATGCTCTTGGTGA
AGCTAATGCTGATCCGACACTGTGCAAATCTTGCCAGCAATCGGTCCAGCGTCGCCAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAATATCATCCAC
AAACGACCGTTGACCAAATACAGGTACCAGCGATGATTCGTCTGATTCCCCGTTCGTAAACATGTCAGCGACGGGGCTATTGACGAGTTGTAGTACCGGG
TCGGTTTCTACCGGTGCTTCGCGGTCTGCCGCGAACTTCGTTTGAAACGAACGATCGGCGCTTGGTCCACGACGTTCCTTGGCCTGTTCTTCAGCTAAAC
GCATCCTCTCCGAGTATTCAAACCAACCTCCTTTAGGTTGAACGAACCCCCAGAGTGCGTTGTCAATCGTACGCTGGTAGATCATCGGCGCGTTCTTTAA
CCCAAAGGGCATGCGTAACCACTCAAAATGCCCTAGTGCGCAGACGAACGCTGACACTTTACGCGCTCGCAAGGTCATCATGACCGCCCAGAAGCCGCTT
GCTGCATCCAGCGAGCAGAACCATAGGTAGCGCTCGAGATCTGTTAACAGGTCGTCGACTAGCGGCATTGCATACTCCATGATCGCGGTGATAGCATTCA
CCATCTTGTAATCAATGCAGAGCCGGATGTCCAGCCCGTTCTTTTTCATCACAATCACGATCGGCGATGCCCATGGACTGTCTGAAAAGACGATCAGTCC
TGCACGCAATAAAGCGCGCAGTAGCTCGGACAGCTTGCCGAGAAATCGCAGCGGCACGCGCCGGGCACGCTGTTTAATTGGGGCGTGCCCCTGTGTGTCG
ATATCGCATACCGCTCCGTAGGCTGGCGGCGGCAGTGCGTTACCACTAGCAATCAGGATGTGCT