Description :
From Genome Similarity Track
Location :
Scaffold_2640:1609- 2850
Sequence
1241 bases(100 bases per row)
CTCCCTCCTAATCCACCCTTCCCCTGTGGATTCGTCTTCTCTTTCTTTCCGATGTGACCAACTCACATCAGCGATCCTCTCTCCTCCTGTGCCCCACACA
CTCTTCTGGGGGGCCCCTCCTCCATCTCTCCCATCCCAAATGTATCCACTCACAGGTCATGTGTCCTCTCCCCTAACTTCTTTCTTCATGAGAATGCCAT
CTCCGCCCGAATCTGGTTACGCATTCCGTACGCATCCCTTCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCAACTGGGTTC
GTCATATCCACGCCAATACACCAGAAATTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCCGACCTCATGTCGGTGATCTTCTCGACTTCATACTCG
TCGGCCTCGATGTCCCACATTCCAACTATCCTCCGGTAGAAGGACTTCGTCGAAGTCGACGCGGTCGGATCCATCCACCGAAAGACGGGTTTGCGGCCGA
TCCGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAGGCGATATTCGGTACCTGCCGTTTCCAGCTTTACCGCATGTTCTCCAA
TCTTCTCGCTCACCCGGAACGGTCCATGCCATAGATGGGCCAATTTGCGAGCGTACCCTTCTTTCACTCGATCCAAATAAAGCCACACCTGCGATCCCAC
TTGGATTTGATGTGGACGGGCATCTTCGTTGTATCGATCCGCTCGATCCTGTATCGCACTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGCCGGTAG
TATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTGCTGCATACTGGGATGGCCGCTTCCAGGGTGGATTTGGGATCCCACC
CATGTACCAAGTAAAATGGGGTATCACCCCGGATCCTGTTTTGGGCGGTGTTTATCGCGAAGGGGAGTCGTTCTGCGCACTCATCCCAATCCCTCTGATC
CAAATCCTGGATACATCTTGAGTGCTCTCGTGATCGTCTGCACCATGCGCTCGGCCCGACCCGTTAGCTTGGGGGACGATATGTCATGGTTGCTCGCTGT
CGCTGCCCCAAGATCCCGGGTTGAATGCTCGAAAGAAAATCAGACATAAAGCCTGGCTCCGGATCATGGTCTAATCATCTCGCTAGCTCCAAATCTTCCG
GAAAAACACTTCCTAGGACGATTCATCATGGTTTGCGCAGT