Description :
From Genome Similarity Track
Location :
Scaffold_67:160897- 163206
Transcript NameFunction/comments
Aphas_H257_14600Hypothetical protein

Sequence
2309 bases(100 bases per row)
AGTACGTTTGAACATTACTACGTAGTACTACTGTTAACCCTATAGGACGTGAAGTCAAACGCAAGTCAAGTATACATAAGAATAGACTTGATTATAGTAT
GGTTTCGTTCAGGTGAGAGATTCTATCACCCAGAACTTCAAGTTACTCGAGTAAGAGGTACTAGTACTGTGATCAGAAACGGCGTAGTTTTAATCACTTG
TAGTCCAGGTGATAAATTCTATCATCTGGGATAAGCCAATCAAACGTCAGGCATCTCTTGTTTAATCCAATGTCGAAAGTATATTGGCTGATATATAGTC
GTACTTTCATGAGTTCTTATTAACCGCCTTTAACGGGTTTGCTTTTACAATTCACAACCACGTTTAATGACGTAGGCATTTGTACCACACATTTGTCACC
TTCAACCGACCAATCAGAACGCTTTGTAAACTGCCACCATTGTTTTTGCCATTCCTGCTGGCGTACTCATGCAATTACTCACAAACAATGTGACGGCCGT
GAAGTGTGGGCATTATTCTACGACGTGCGTCCCCCGCACTCGTCCTCTGCCGTTCCTCGTATGGCTCCATCCACCTCCTACCCCTCCAAGCATGTGTGCT
TGATCCTTGTCGTCCTTTCGTCCGTGTTATCCGTGGACGCGGCGGCGGGCGGCGTCTGCTTTGACGTGGCGGACGTGGGCAACATCGACAACCATTTCCG
TCAAATCAAGACCAAGTTCTCGGCCGTGCGTGTGTACGAGACCCAAATGGGCAACACGAACGCGATTGCCGCCGCCGCGAAAGCAGGACTTCAAATCGCC
GCGGGTGTATGGATCCGTAGCGGCGACGCCAAGATCCAGGCCGACATCGACGCCGTGGCCGCCGGCATCAAGGCGTACCCCGGCACTGTCGTCGCCGTAT
ACGTGGGCAACGAAGACCTAGCCAACGGCGTGTCGGAACAAACTGTGATCAACAAGGTGAACCAAGCGAAGGCGAGTCTCAGCGCGCTTGGCGTGCCGAT
CGGGTCTGTGCAAGTCGACGGTGATTTCTTGAGCGCCGGGCGACTGGCGGACGCATGTGATGTCGTGGGAGTGAACATCTACCCGTACTTTGGGTCGTCG
CCCGACTCCATCTTGAAACCCATCAACGACCTCAACGCTCGATGGAAGCAAGTCACGGCCAAGTTTGGCGGCAAGGCCAAGCTCACGGAAACGGGGTGGC
CCACCAGCGGCACGTACAATGGCCACGTCGGCAGTTATGACAACGCCAAAGCATACTGGCAATCGTACTCGGACTGGTCGTATGGCAACGGGGGCGGTGT
GCCGTTCTACTTTCAGCACAAGGACATGCCAAACAAGTCGCCCGAGTTCGAAGCGAACTTTGGCCTTATCGATAGTTACGGCAATTGGAAATTTGACGTC
GCTCCGGCCACACCTCCGCCGACCGCACGACCTACATCCCCACCTACGGCACCTCCGACTGAGCCCCCAACTCAGCCGCCGACAACTCAGCCGCCAACTC
AGCCACCGACAACTCAGGCGCCGACAACTCAGCCGCCGACAACCGCTGCACCTACAACGACTGTAACGCCTGAGCCTACCACGACGACCGCGGCCCCGAC
AATTGCACCTACCACGGCCACGCCTGAACCTTCGGTTACACCCACGGTAACACCTGAACCTACGGCAACACCTGAACCTAACGTTACCACAACACTTGAA
CCCACGACAACGTCGGCAACAACCACACTTGTCCCGTTGAATGGAACCAACACGACTTCGTTGGAAACGGTCAACAGTACATCTGGGGATGGAGTTGGGG
ATGGAGTGACGTTCAACGGAATCAATGGGACGTTCGATGCAATCAATGAAACATTTGTGACTTCGATTTCTGACGGTGCCTCGAACCCCACTGGCGTATT
GATTGGAAGCGCGGCTAGTGGTGCTGATGCTGGTGGTGATGCTGCTGGTGGCGGTGTGGCTAGTGGCGGTGCGACTAGTGGCGGTGCTGCTGCTGGCGCT
GGGTCGTCGAGTTCCTCCAGTGCGACATCTATCGGAGGGACGGACAGTACCAATATCAACGTGTCCTCTGCCGATTCGTCTTCATCCAACCCCGCCCCGA
CGATCTTCTTGACTGCCGGAGGCGCGCTTGCAGTCGCTGCTGCTGCGTTGTTTGTGGTTCGTCGTCGTGCCCAGTCGTTGGAAGAGGACAAGGACGCATT
CGATCCTGAATTCGGTCTCCATACGCCTCCAACGGCCCTCGGTGGCTACCCGACTCAAGTTTTCACGACCCAGGCAAACGCAACCCCCGTCGCCACTGCT
TCTACAGCG