Description :
From Genome Similarity Track
Location :
Scaffold_115:16085- 18416
Transcript NameFunction/comments
Physo_158536hypothetical protein

Sequence
2331 bases(100 bases per row)
CTTGGTGCTGGGGCGGGCGCTGTGATACCAGTCGTCAATGCTCTTGCCATACTCCTTGACAATATCGAAGGTCATCACGTAGACCGGTGGGTCGGACGGG
CTCGTTGCAGCGCCATAGTTGAGCAGTGGACCATCGGTGAGAACCTTCCAGTACCCGAAAAGCTCGGATTTGTAGTTGGCGGTGTACAGAAGCTGAAACA
TGGGCAGGTTCACAAGAACTTGACGCAAAGCGTCCCACTGGTAACAACGCTTGAGATGCCATGGCAGTTCCTCGACCCGACGGAAAGTGGTTGGGTGGAT
ACGAAAGAAGCGAATGAGCCACTGATGGTACTGCTGCTCCGCGCGCTCGCTGCCGATGTAGCGCCACCAAATGACGTCGCGCAGTATATCTTTACACATT
GGTAATACCACAACCTCCTGGACGAAGAGCACACTCAAAGTGCGTAGCGCACGTAAGAGCGCTTGCCACTCGTCGTCAGAAAATGCTGTCAGGTGTCCCA
TGCTTCCTTTACTGTCGAATGACGAATTTTCATCGTCAGAGTTATCCCGACGGCGGTGAATACCACGTGCCTCAGTCACCACAGCATTGAGAATAAATCG
CAGTTCATTCAGCAGCAATCCGTGACGACTGACGTAGAGAAGGCACAATGCTCGACCAAGAAGCTCCCCCAGTGGCACCACAACGCGTCCACCCGTGAGA
TAGTCTGGCCTGTTGCCAAGCTTGTTGAGGGATCCATTCTTGCTCCCTCTGGGCTCGGTGGAAAAACGTTTGAGCTTGTGTCGTACGGCTTCCAGCATGG
AGCCTGTTGCGGACGGGCTCTTCGAGTCCATCGATGTCGAAGCGGAGCCACCTTCCACCGTTAATTGTGCTCGAGATCCCTCCGCGCGTGTCATGTTCAC
GAACATCTCTTTGGTCTCGTGCACACTTTTCACGCGTTTGATCTCATTCCACCCTGGATTCGAGGTGTTGTCGTCATCTTCACGTGGGAGAAAGTCAAGA
GGGCGCTGAGAATCGTTGGTTTCACGAACTGCAGCCTCAGCAGCAGCTCGTGCCATCTCAATTTTTGCTCGAGTATCGCTCTGGTGGAGGGAGAACCGAC
GCCCAGAAAACTGCGGCAACTGGGGGTCTGCGCCCGACGTTTTTCGGATTGAAGCTGAGCTCGCGATGGAAGCTGTGGCCCCAGAAGGATTATGACTGGC
GTCTTCTCCGTACTCCAACAAGAACTGCATGGCATCATCTGTCGAGAGTTGGTCAGGCGTGTATCCAGCCTCCATGCTACGGAGTACCGATTCCAGCAGC
TGACCCACACTGTCAGCGCCCAGCCAGCTTTCAAATACGGCGTGGATGTTGAATCCCTCCTTCACCGCCCAGAACAAGCACACAAGGAAGTTCTTGAGAA
AGTGGGGGCTGGCGCTCATCGGCACGCCGACGATGGCATTCTGTTGGATTTCAAAGAGTTGCAGCCCCGTTCTTCTTGGAGATCCGTCTTCATCCTGGTC
GCTGCTGTCGGAATTCTTGGAGATGAATTTCTTGACGATGCCCCTCCGGTTTTCTTCGGCGAGTGGGAGGACGTGTATGAGCTTCCAGTTGCGACGGCCG
GCCTCCACTTTGATCCTCTCGATCATTTGGGCACTGAGACTCGTCTTCTCGTAGTAGTCACCTCCGACCCCGACCTCATCGCGTCCTCCTTTATCGCCTC
GCAGTATCGTATAAGCAGGCGAACCCGCCCCATTGTTAGTAGATAACACCTGGGATAACTTGGCCGTGGGGTAGTTGAGCGTCCCTGAGAAAATAATGCG
AACATTGGGCGGAAAGGATAGCGGGACCCACTTCAAGATGCTCTCACCGTTGTTGGTATGCAGTCGGTGCAGCCCATCGACCACAATAATGACGCGGCCT
TTTTTCGAGGCGGACTCCAAGAACCGAGGGAACTGCCAGCTTAGTCTTTCTTCCACGTCAGGGATCTCTTTGGTGAGTTCAAAGTACTCCTTGATCTCTC
GCAGAATGCGCTCGAGCAGATTTGATACAGAGCAGGACTGTCGTGAACACCCTACGACGTGCGCAAAGATGAACTCGGGGTACGAGGACTGCCAGTTCTG
GAACATTTTCTTCCGCCGCACGACCCAATTCGCGAGGAAGGCACTTTTGCCCATTCCACTCTCGCCCAGCAGAATCACAGGACCCTTGGGGGTATGCATC
CCGTCAACGTCACAGAATTCGTCAAGCTCTCGAGTGAGTCGCGGGTCTTCGTGGTACACGAAGTCGCCTGTTTTGAGGCGCAGCCGCATGAAGCCATGGT
GGAAGGCGCTCTCGAGATACGACATGGAATC