Description :
From Genome Similarity Track
Location :
Scaffold_253:16085- 37086
Transcript NameFunction/comments
Phypl_g6005hypothetical protein PHYSODRAFT_516871

Sequence
21001 bases(100 bases per row)
ACTAGCCTGGCCGTGGTCCtcttgctggccaagctctTCAGTGCTCGTTTCGTGGGAGATACCGATGTCTTCGGTCGCGGCGGTgtgtccagcgccaccg
ccggcCTGGCAGTCGTGGGAACGTCTCGCTTCTCCGTCTGCACTCGCTCctggtgcttcttcttcaagacCGACTCAAGCGCCCGCTTCTTGGGCGACAG
CTTCCGGTTCTGCCAGAACACGTACGTGTCCGTAGGGTGTGCCGCGCCCTCGtccgctgcagcctcttcatcgtccggCGGCAATTCTTCCGTCCCTTCC
TCGATCGACGCAGTCCTCGCACTCTTACCCCGTTGCatcagcggcggcagcagcttcccgCTCACTTTACGCATCAGTTTGTGAGCGAGGGACTCACGCC
GGTCTCGCAGTTCGCGAAGGAGGTTCTGTCGCTTCACCAGTAATTCAGCGCGCGGGTCCGCGTGTGGCCCGAATCGGTCGGACGAGCTCACCAACTTCTC
GTATTTGGTCGTTGTAGATGTTGGCTGCTCTGCACCCTCGGTAGCTGGCGTCTGGAGCTGTTGGTGGTACAATCGGACGCAGTGCATGCCGTACAGGAAG
TGCTCAAAGTCCACGAGGTCTGCGTACGCCGGGTCAAAAGCCTGTAGCAGCTCGCGGACTTTTGCGGCTGGAACGTGCACACCCAACTCGTACACGGCCT
GGACGATGGCTGTGTGGGGGACCAAGCCGAGCTGAGCTGCATCCGCCGACGCGAACAACAACCTGAAggcctcgatctcttctTCGCTGAAGTTGTTGAT
CGTCTTGCGCAGTGCATCGCGCCTCTGGACAGCCAGTGAgcggtgctgctcctgcttgtgCGCccgaagctggcgcagatATCGCGCACGCGTGACTCGT
GTGAGAAGTCGACGCTGGATGcgaacggcggcagcatAACGAAGGCGGTCGTACAGCGAAAGCGACTTGCGCCagtgctcgcgctccagaGCTGCCACGT
CTTGTGGCCCAATGCGCAGCAGAGCACGACCACGCTGGACGATCCTCGCAATCAAAGTGCGAGACCACCAGTCACGCAGCGTACGAGCCACGATGGACGC
GAGTATCACAACAGGCTCTACCACCAACTCCTGGATCGCTAGACCAACTGCCCAAGCAAGaacgcagcgccacgacgtggCCAACCCAAGCTCCATCGCG
CTGATCGCCACCGCATACGCCATGATCGCCAACCACAAGAGGCAGATCGAGAACACTGCGTACACTATGGACGCTGGATACGGGACGTTGCCACTGTCCT
CGCCGACATCGTCACTCGGCTCAATCTTCGCTACGACGTTGCCATCATGGCtttcttggccttcttgagtACTGGAGATCAGTACCTGCTCATGCTTCAG
CGGTGCTGCCGCCAGCTCACTTGCCACCGACGGTGCGACGCTGTCCAAACTCGAAGCAAGCATTTGGGAGCGCAGCTTGCCGCGCGCAGGGGCTGCGATT
TTGAGTCCGACAACAGTCTCGAACGTCTCGCGCAAGTCTCGCTTCACCTCACCCTCGTTATCTCCAGCGTCTggcacgcgcagcttgagctttgCATCTT
TGGAGAtggccagctcgcgcgcgagGAAGAGAGCAGTCGCCACCATCAAGAACAGCaaacctgctgctgtcagtgCGCAGTACGTTGCAACGTCCGCGCC
AGTATGGAATCGAGCAAGCATGCCCGCACGACATCCCGGTAGCGTAGTGAGCTCCTGCTTCGTTTCAGTCACGACCGTGCCGCTGACGCTCAATGCTTCA
TACGTGACTTCAACGGGGTCGCCTTCAGGACATGGCGAGAACggcgcgtctgcagcgctcCGAAACCCGCAACACCGCAGTTCCTGCTGAACCGTGTCCT
TCGCGTAGCCCGTGAGCTCTTCTTTCCACGCCGTCTCAAGTCGCTCAACGACACTGAAGCCCGTGGTGCGAACGCTCCAGCTATTCAGCGCACTGGCGTC
GTCCTGCACCACTTCGTGAACCATGAACACAGCTAACAGCACCGCTCCGAGCGCTAGTACTGCAAGAATCGCCACTATCACCAGTGTCACGATCACCGGA
GTCACCTTTCGACGATGCGACCGCTTCATCTGCTGTTCTCGGAGGTCGTTTGCCAGTGCCGCGAccaaggcgacgacgatcagtgcgccagcgacagcaa
ggagctcgagcacatCTTCATCAAGCGGGACTCCATAGAGAGAATTGTTGTACCCCAGTCGAAGCAGTCCGAGTAGTGTCGCGAGTGCACACCCTCCAAG
gaacagcaccacgccgcAAGTCTGGAATGTCAACGCCACAAAGCGTGTAAGCCAAACGAACCACCGTTCCTCGGTAGTGGTCTGTGTTCCTTCAAGCGTA
GAGGTGTCATTGTTCAGAGCTGAGTGCTCCATGGGCTTCGAGCACTCCTGAATGTCAggccggcgtcgtcgaaACCACGGCCGACGGAACAGCAGAACCT
TTTCTTTCCGCTGTCGAGCTGTAGCAACCTCCTTGGTCTCGTCATCACCACGGTGTCGAACGtgctcgaacagcgcgacgGCAGTAGTCTGCACTGCAAG
cccgacagcgccaccatACACTAGACCGAGACCAATCAGCTCCCCCGCACCTGGTTGCTCGCACGACTTCAGTGACGTCCGATAGCATCCCTTCGTGGCG
AAGTAACCTGCATACACCGCGAGCGAGGCGGCCCATGCGCAAAGCACACTCAccgcacgctgcgctcgtGTAAGACGCGCATCAAACCTTGCGCCGACCG
AGACCAGTACGTGATACCGCCGGAAATCGCGACGGAAGCTACCTGCCACGTAGCGCAGCCTGCTCTCAAGAGCAAACCAGGCTTCTCCTTCGTAGTTTCG
GACGTCGCGTAGGACGAGAGAACCGACCACCATCACCACGATTTCCAGGAGTGCAAGCGCCAGAAGGAACGCAAACAACCAGGCAAAAGACGACTCAACG
CCCGTCATAAGAGGCCCCTTGCAGCCTCGGGAGATCGCGAGCGAGCAACCTGGGTATCCAAGCGCTGGACGGTCAAACACGACACCTTGGTCAGCCACGA
GCACGGGGTCGTTGAAACCACAGCACGAAAACTCGAGCGCTATCATGTTCTGCGTCGTCGGCTGCAGTTGACTCCACTGATCAtccaggaactcggcgag
tTGTTCATGCCAGCTTTCCTCCGATAAGGAGGAATAGTGCGAAAGGTGAGCAGTGAGACCCACAGCCGCAAACAGCGCCGCGGCGAGTACGAACCGAGCA
ACACACTGCAAGAACAGTTGATGCACACGAAGTTGGAGGGCGGCACGGGTCGAGTACGCGTGCGTGAGTAGAGCGAGCGCACCGTACAGCATCAGTGACG
CGCCCATGGGTCGAGCGAACACCATTTGGAAGGCACTCGAGCTGAAGAGCGTCCAGCCAACGGCCACATCCAAGCCCAAGATGGAGCACGCCACCGCAGC
TAAGCCCCCCGCTAGACCAAACAGTAGCAAAGCTGACCGCTCAATGCGAAGTCGCCAACCAGGACGCCACTTCCTCTCACGTTCATCTGTGTCGTACAAG
CCACTGGCGCAGAGCAGAGCTCCAACGCTAAAGCcggccaacgcgctgcacAAGTGCCAGGCTAGTCGCGCCACTCGAGAGACGTACTGCTTCATAGGGG
TCGCACATCCATCGGACGCATCCGTGGGGCATTGGGGGCCTCCATCCAAGAGTGTCGCCTCCACCTTGGTTTCTGTAAGCGCACGAGTCTTCCGGGTGTC
CAAGTCGCTTCGCGAGTTAAACACGTGATACGTGGACGTTGAGGCGAGTCGCCGCCACCCGAATTCTTCCGCTTGCAGTGTGTACGACACCGAGCCGTTa
gcagcttcaacgcgcGCATAACCACAGCACTGGAGTGTGTTCTGTACGAACAACTTGGTAGTAGATGGAGCTGAGCTCCAAAGCTCCTTCATCCGCGTAT
CAACTGCTAGTTCTTGAGTGGTGTTGGCGTCGCCGTCAGTTGTAAGCGTGAACTGAGAAGACAGTTTGTGCCCCACACCAGCCAACACGAACGCAGcaat
gaagagcacgacgcagACCAGCGAGTAGCATATCACCAGCCACTTTCTGGTAGTCTTCCGTCTTGGTCCTTGGCGCTGCGTGCCCAACCACGCTACAACG
CCGCCAAAGAGCGCAAATATCTCCATGGCACCTCCAAAAACGAGCAAGTAGACGCCTAGACGGCGGTCGAACACGCGCAGCAGATACGACAGTTGCAGCA
CATTGAGCTCGAAGAGTACGTCAATGCCTAGGCACAACAGTCCAACACCAGCCGCTGCCGCTACCACATTTAATAGCAATAGCCCGCTCCCACAAAGCTT
TTGAGCTAGCGTCGGGGGTTCACGAGCCCTGGAAGCTTCCTCGTCGACTGGTGTAGCTTGAATCACAGCCAGACTCGAGAACCGTCGTAGCCGGAGACAC
AACCAAGCCACGAGGACAACTACAACCGCCTGAGCCACTGCAAAGCCTGCAAGACGATCTGTTGCCAGGGATAAAGCCCGCTCCAGAGCCTTCTCCACTG
GCACACGACAAGTAGGAAAGTTCGCATCGGATGCACCTTCAACACACGTCCCTTGTGAGCTGGTACGAAAGCCGCAACACTCCAAGGCCATCTCCAAAGC
CAACAGCGTTGTTGAGCGTGGCAGCGCCTCATACTTCGCCTCGACCGCTTTGCTGATGGACGGGTCCGCGTAAAAGTCGGCAACAAGTCGTCCGATGTAC
GCGCGTACTGCTagcgtgagcagctcgaaggtCAGTGACAACCCGAGAACCCAACGGAGAGCTCGCACATCACGTCGACCCAGCGCACGCAACGCCCACA
GCGCGATAAGCAAGTAAACCACCGCTCCAGCGATGACAAAGGCCCCGATCTCAACGCCAAACAGTTCGGACACCAGTGGATCCGCCAGTGCACCCCAATG
TACCATCAAATCCGCTCCAAAGAATACCCCACCGGCGGCAGCACAGACGAGCATAACGTATAGCGGTGGCAACGAGCACAAAAGTGCCGCCGATACCAGT
GAGCGAGCAATCGCCGCCTCAGCAGTGCCACTCGTAGCGAGCTGTAAGAGTCGAATCCGCCGCCACCCAACGAGAaagttggccagcgccacgcacgcga
tctccacgaacagcgcgacTTCCACGTAGACGAAGGAGCTCGAAAACAAATTGGAGGCTTGCGCGCCCAGGATCACCGAACACGTTCGAGGAGGCACCGC
ATCTAGAGCTTCCTCGGGGCAAgacgcttcctcgtcgatAGTGAAGAAGCCACAGCATCCATAGGACGTCTCCAGTTGGGTCTTGTCTCCTGAAGACATA
GCGTCCCATTTGGAGCGCAGTGCAAGGGCCACACCGCGCGGCACGGCGTCGAAGTTCTCAAGCAGGTGAAATGCCAACAGCACAACCACAAACTGCGCCA
GCAAGCCGAGACCTAACGACGTCAAGTACGTCGTTCGAGCAGCGTTCGAcgcttctcgtcgtgcaAGGAGAACTCCTGCGACTCCTGCTGCGACCAACAC
GGCTCCACCCACCATGAGCGTGACTCCGAGTGGGCCTCCGTACAAGTacagcacgagctcggcCGGCGTTCGCCCCAGCACAAACTGCACTTCAATGcca
gcaaacagcagcacgacgcccaaCAACGCCAACAGGAGGTTGCTCAgccggaagagcagcgtcaTTCGACGGTACTGTTGATCCACAAGACTCGACGACC
CGAACAAAGTGCGTGCTTCATTAGGAAGCTGGACGTTCGTGTCTAGTGGCTCGTTGGGAGGCTCCGCCATTGCAATGCCGTTCACGTGCACAGACGAAGA
GAGCAGAACCGCTGAAGACTCGTCGACATCTGTGGCTGCGGTTGCCGCCTCGGAAGGCCGAGCTTCCAGTCGTTTCTCCTTCTGAGCGACGTAGTACGCG
TCAAAGTCCTCGAACACGTTGGCGCCCTGTGTCCGCGCTTGCAGTTCGCTCCACTTGGCGCGGTTGAGCCTCTTGATCGTCGTGAGCTTTTCGCGCTGAA
CGTCTCGATcatcgagtcgctggccgaccttcgccaccaccacaaaGACGCCAACCAGGACTGCAAGCGTGACGCTGACAACGAGAGAAGGCTGGTCGTC
TCGGTACAAACCGCGATGCAGCGCGTAGAAGTCCAAGCGTTCCTCTAACGTTACGAGCACTTGGAGGGCGGACTCGACCTGGGTGCAGTAGCACACTGTC
CGttcgctcgtgctggtgctgtcgtcTTTGAAACACACGTCCACAGACCAGCTCGAGATCTCGGCGTCCCAGGTACGACAGGCGGTGGAGAAGTTGCTCT
GCTCAATAGCCGACAGCTGACGCTCGTGAGGAATCGTGAGAGCTACGAGCGGCAGCCACTTGTCCGTCACGGGGGCGTCAGACGCCAGACGACGCACAGA
GTTGGAAGCGGCCTTGACGCAGGCACTCGTACCCGACAACGTCTGCATGGCGACGCCAGCTTCGGAAGAGTACGCCGTCACCGTGGCAGTCTGATCCACT
GCGGCTCGGGAGTGCACGGAGAAGAGCGTGAGTCGAGAAATTGGTTCCGAGTCGTTGAGAGAGCACGCCGAGTGCGGGCTTCGAGCGAGTGACAAGGCGT
CCAGGTACAGATCCGCGTCGAGACACGCGAGTGCAGTGGACGTGAGATTCATCGAGACTTGAGTCGTCGGAGCCGTGAAGCTCACGCCTTTAGCTGAATA
CGTGCGcacgtcgccagcttccagAACGGCGGGGGgctcctccgccagcagcccATCACTGCTCAGTGCTGTTAGTGATTGAAGTGTACGCACCATATTG
TCCCAGTTCGCCTTCTCTCCGACGGCATTGACAGTGTCGGTGCATGTCGAATTGCCCGAGTCTGCCTCTGCAAGACGACGGGAGCTGACACTGGAGCTCC
CAAGCCCGAGAAGAACCGAgatcacctccagcagcgtgtcaCTCGTCGagtccacgaactcgcccGGAGCTGCTAGCGTGAGTGCACTGCCGGCAatgcc
gctgctgagctgaGTGACAAGGCCGATCTCAGCATCGCCCAGCACCTGAGGCGCGGCCCGCATGATGGAACCGAGCACACGAGCTTGCTGTCCAAGTCCC
GAATTACTGGCTTCGACAGAACGAACCGCgctcgacagcgtcgccagGATCGCAGCATTGATCCTctggacgacagcgatcTCCGCAGTGCAGTCATTCC
CCATGAAGCCTTCCGGGCAAGCGGCAAGCCGGCGAGATTTCTTCGATGAGGAGGCCCCGaaggccttctccagcaccatggcgcCGGCCAGAACCTGCCG
CACATCTTCCGATGCGCCGGCACTGGACTTGAGCGTTCCGCTGGCGTCAAAGAAACCCGAAACAAAAGCTGTAGGCGACAACAGGGCTGCGTCGGGTAGC
CGCACCTCGATGGTGTCGTAAGCAAGCGCCACTGCACCAAGGCGGTCACTGATAAACGCCAAGACTGTCACGCTCTCGCTGTCCGCCAGGTTAGCAGGAG
GGAACATTATCACTGTCGCTGAGGGTGCCGCTTGACTCGCCACCAAAGGCGTCATCGACTTTCGCAGCTGAGCCACCAACGTGTTGGCGTCCGTCGCATT
ATTCCTCAGTACCTCGAAGTTCGCAGTGGAGAGCACGCCAAACGAGTACGCGAGAGGGTAGTCgcccacgtcgtcgctccacAGGGAGCACGTGAGGGTG
AATGCGTCCTGCATCGCGTAGCCGGATTGCGGGCTCACGACAAAAGTACCAGAAGTAGGCGGCGAGTTCACGACGACCGAGACGGATCCAAAGCCCACGT
TGCCTTCCGTGTCGTTAGCCACGAGGCGGAACGTGTACGTGAGCCCCGGCGTCAGTTTGAAGCTGCGGATGGCGTTGTTTGCGCTCGTTAGCGGCAATGT
GAACGCGTCACTGGTGTCGCTCACGTCAGCTGTCGGCAGCACGAGGTCCCCCAGAGTTTGAGTCCACCGCGTCGTGTACGGATAGTCCGAGGCCGCCGTG
CCGCTAAGTACCAAGCGACTCGACGGGTTCATCTTCGCGGCGGACGCAGTGACGAGAACGACCGGGAGATGACCTGCCACGGTCCAAATCgtgctcgaag
ctgtcgcACTTCGAGAACCTTTTGACGCCGTCAACGAGAActtgagctggcgcttcGACACGAGGTTGAATGGCGCGATTCGGAGCACAGGCCCCGTCGC
GGAGGTCAACACCAACGGAACGGAGGGCGTGGCCGACGCGTTCATGCACGAAACCACAGATGAGCTCGACGCATTCGTCACGTCTTGGCACGTCCACACG
TAGGAGAACGGCGCGCTTGAAAAGTCTGGATCGGCGGTTGTAGACCCGTCGAGGACTAGCGCGTCTCGCCCACCAAGCGCACAGTCACCGCCTTTGATGA
AGACCTGTggcaagctggtggagacgatCACTGTGAGCGatgcgaagctgctcgacgttTGACTCGCAGATGTTCCCTTCATGTAGGCCTCAGCCCGGAA
AGTGTATGTGAGTCCAGGCCGGAGCGACGAACGCGGCAAGCGGAACACGCGCGGGTCTCGAGCCGAGTTGTCCTTGCTCAAGTCTTCCGTGGTAGCTGCG
CcggtgccgtcgctgctttTGCTGGTCGCCGTCCACCGGTAGGCGACATCCGAGCTCGATAGAGTCGGGCAGCTAACCACCGAGTCCACCTGCATCACGA
CGGGCGCGCCAACCCTCGTCACAGTCTGCGTGGACTCGCCCACGATGAACACCGCCGGCCCTGGTTGACTTTGTATGGAAACAGGCTTGGAAACCACTGT
GGTTTGAGCGAAGGCGTTCACGAGTTTCAAGCCGACGCGACAGCCCGTGCCCGGTTCGAGCAGAGAGCTGTtcacctggagctggagagcacCCGCTGCC
GTCGCGTTTTTCGCAACCGACCGGAGATAGCACGCAGCTCGGAGCTGCGTCATAATGGTGAGAGTTGAGAAATCGGACGTGGCGTTGGCGTTCGCCGCCG
TAGCCAGCGTGATATCTGCAGCTGGAACCACCGCAACGCTCGACGTGCCAGTCGTCCCGTCCGTTTTGTACTTTTGGCAGAGCAGTGTAAGACCCGCATC
GAGTCTCTGGTACAGCGCCAGACCTGCATCGGCCCTCGTTTGGTCGATTGAGCTCGAGTACAGCGACGCGGGGAGTGCGAACCACAGCAACTGCGCGTAC
GGACGCCCACCAGCTCCGCTAGACAAAGACGCGTCCGCCGACCATGTTCCGCAGCTACCAGCGTTCTCGGGAACCACGAGCACGGCGCTCGGCTGAACGA
TGTCGACGGGGACCTGCACTGCAATGCTGGCTTGAGAATAAGCGCGACTTGTGGGTCCTGCTCGCAGCACGTCCGTCGCATTGCAGTATTGGTCAgcgaa
ggagctgcagtcgttCAGGACGAGCTTGTCGGCAGCCGCTATGGTCGCTCCGGCGCTTGGCTCCATTCGCAAGTTCTTCCCATCGACCCACAAGCAGTGA
GCCTGAGCCCCGAGCGTGTacttggcagcagcgaagtTGAACACGAGGCTGCACGGGAACATCTTGAGCCGTGTCACAAACGtcccggagctgctcacgt
ccatggcggcggcgtggtAAACCGTCGAGTCGAAGGCGACGTTGATCTTGGAGCCTGAGCTGTCGAAACTGGCAGTCACGGGCAGTGGCGGAGGAACCGC
CTCCCTGTCGCTGATCATCACCGACACAcccacgacgccgatggAGCTGTTGGAGGTATTGTAGGCTGCATCCGCACTTGAGACGGAGTGGAGGACTGTC
GAGTACTGCGTGGCGGCTTCGGGGATTTCGTCGTCGATAGCGAATACCGTCACAACCCGCGGCCGGGACCAATCCAGAGGCGTGAAGACCAGTTGAATGC
TGCGAATCGTCTCCGTGCTGAGGACAGTCAtcgccgaagacgacgacgaaccgAACGCAGCCCCAACCTGCGGCTGAGTGAAGACGCTCTTGGCGTCGGC
GATGCTCTTGACCTTCTCGATCGCGGGACGTAACGTCACGGTCACGTATTCGTACGGCTCCGAGTTGAGGGAGACGCTGTAGGAATCGTTAAAGCTCCCT
TCGGCCACATGCAGGAGGTTGGTCGCGCTCTGGATCGAGATGTTCACGTACGACACGTCGTTGTCGGTGATGAAGAGCTTGACGTCGCCACCACTTGCTG
CGTAGTCGCTAACGGCGTACAGAGGGtccgagctcagcgacgcgtGCGAGATCCGAGCCGTGTGGACGTTCGCCTCGTCGAGCCAGTCGTCCACTGCCAC
GAGCGACACGTTTTGCCACACGCTCCAGTTGCTCGCGCCAAAGTACAGCGACGCTGAGTCTCGCAGAAGACTGGCGTTGCACACTCGCTCCGCGGTTTGG
ACGCGTAGGTAGCAGTCGTAGCTGGCGTTCGGCTGAACGACCACGGGTGCCCACGGCTCCGAAGTGAGACGGACGCTGTACGAGAGCACAGTCGCGTTGC
TCTCGGTTGCGTGCAGCTCCCGCGTCGACAACTCGATGCCTGCCTTGTCATTGTCAGCGATGAACACCTTCACGGACGCCAAGTTCTTAAGCCCGGCATA
GATCACGTCATTCGTCGTGAGCGAGTGGTTCAATGTGCTTGAGGAGCCCGCGACGTCTTGCGTACGATCATCAAACGCTGTCACGTTCACCGTTTGCGTT
AAATTCCAGTCGCGCCACGTGAAAACCAGCTTCGTAGGGCTCGGTACGGCAAAGTTTCCAACAGTGCCGACATTGGTGGCAGCTACGGTCACCCTAGCGA
ACGGCTCCGAGGTCAGCACAACCGTGTACGAGTCAACGGCCCCAAGACCCTCCGTCACGTTCACGCTGGCCTTGTTGACGATGAAACCTGACACGTCGTT
ATCGTGCACAGTCACGTCGATCTTAGGGATCGTAGGGATCGCGTTGTACTTGCGGTCGTCGCTGTACGAGATGTGCGAGATGCCAGTCGTGTGCGTGTCG
TACTCGTCGAGGTTGTCATCTGTAGCGAGAACTGCCACCTTCTGCGGCACGTTCCAGTTCCGCGGCGTGAATAGGAACTCGCTTACAGGGAGAGTGAGGT
TGCAGAGCCCGAAGCGGTAGCACTgcgtgttgttgctgtcgagcCAGGGCAGAACGACGATCTTGACGTCGACTAGGGGCTCCGAGTTCATTTGCAAGTA
GTACTGCGCTGTGAGgacgccgtcctcgctcaCCTCGAGTGCCGACTCGGACACAAGCACCTTGGCGACGTCGTCACTCTCGACTTTGACCGTCACGTCA
GGCAGAGGAAGCgccaagtacatgtagtcgtCACTGAAGACGGTATGCGTCACCTTGGAGAAGGTCACGGTGCCGTTCTCCGTGGTGGCCTCGTCGAGCG
AGTCGTCCACAGCCTCCAGCTGGACTTGCTGCGGGACGCACCAGTTCTCGGGTGTGAACACGATCCACGGGTTCAGCACCGTGTAGTTGCAGACGAATCG
TTCTTGAGCCGTCTCGTTCGCGATGGCATAGACGCAGTATCCACGAAGTCCAAGCGGATCAGTCGGGTCAGGCTTGAAAAGCGCCGTGGAGATCGCTGAG
CACCTCGGTTTGCCCAGAAGATCAAGTTCCGACGGGACTGGAAGAGGCTCAATCTCCTGCGTCACTCGAGAGACATCCATCGAGATTTTCAAGTCCGCAA
AGCGCGTGTAGTCCTCTAGCGCCCACTCGAGCCTCCACGTATGACCTCCATCGAGAAAAGGCCCCGCACGATACACGCGCACGCCCTTGTCAAACTTTAT
CCCGCGCCACACCTTCGTCTCTGGGTCGTATTCCGCCTCACGGTTGGAGCGTACGAAGGCCAACGCCTCCAGTGCTTCATCCATTCCAATTGCACTTACA
TTGACCGGTAGCCACCACGTCGTACCGACGTGCGTTCGATTAGTTGCTGGGTCTAGCAACTCCAGtcgcagcttgaagctgccgcccaAATACGTGCCAT
TGGCAACGGTGGTGGACGTGAGGGCCACGCCGGGCGCTGTACGCATCGCATCATCTGCAAAGACTGCAATCGGTGGCATATTTCCCGGGCTGTTGACGTA
GCTGACCGTCCACGTGTATCCGTTGCAGACGTTGAAGACATCGCACTCGACCCCGACGCGTGTTACGTTCGTCACTTCCGTGCGCTCGAGCGCGAAAAGA
GCTCTTCGAACCCGCCAAGCTGGTGCGTTAAACGGCAGCAACGTGCTGTTCTTCAGTGGCAGATCCATCATGTAGGCGCGGCTGGTCCGTGGATCGGTCT
TCTTAAACCGGCCGCCCATCTGAACGGTGAAGTTCCCTCGCAAGGGCTCTCCATCACGCACAGTGCTCACTCCGACGGTGACGCCCTTCCCGGTCAAGTT
GAGTGACGTTACCGTCATGCTGGGTAAGTTCCCGTAGTTCTCGAGAAACTGGACAATCCACGCCATTCCTCCTTCCGCGGACAGTTTGTGGCATGCCACC
GTCACGTTTGCGACGCCCTGAAGCTGCGCCAACTTGGACGCAAGCGTGTCAGCCGAGTCGTTCCAGAAGATCGGCACCGTGCGGTTGGGCTTGGAGGACG
TGGTGACGTTGAGTGGCGTGTAGTAGTCGATCACAAAGGCCCCACTCATCAACGCCGGTGgctgcgtctccgccaccGCAACTGCCACTTGGGTCGTCGA
GTCCGCAGAGGCtacggcgctggccgtcgaATTCACTACCAGACTCGCGAAGCTTTCCACACGCACAAAGGTGACGATGTACTCGAACCCGTAGCCGGTA
CTACTCAGCAGCCTTCGTGACACTGATACGGAATAAACCCCCGTTTGTGAGCTCAGTGTGCtctgcagcacagcagccgTCGGCACGATGGGCACTTGGA
ATGTTGCTGCCCCATAGCTCAGTTTGGCTGAACCCGTGGGGAAGCTACTCGCTCGCGTACTTTGACACGTCAGCCCGCCTTGAAGCGCCCCGTTCGCCGC
TACCGTTAGAAGAGGAAAAGTGCCGTCCGAGCTCACAAACCGCAGGAACGTGACGCTCCAAGTCAGGGTCGAGTCTGCATACCGAACGTCTCGCGTCACA
CTGACGGCGCTGGTTGCGCCAGGAAACAGCGCGTTGATCGCTGTTTGGACCTGTACAGCCGTGGAAAACAAGTCCAGAGCCGCCGAACTCGGGGACCCTG
CTCCATTTGCGATGGTAAACgtactgctggagctggcagtGGCTGCGATGGCCTCGGCAGACGTGTACCGCGCTTTGAACGCGTCGTTAAACGTGAAAAC
GATGGCCTGGGTCTCCGAaccgaagccgccgaacACCGAAAGCTGGAAAATCTGGTCCACGTGGTCCGCGTAGGTCACGATTCGCTGCACTTCCGTGACC
TTCGTCATTCGCAAGGAGATTTGGTGGATCTCAcgcgtcgagttcgtgcgcaggtggacgagacTCACGCTCTGTTGACGAGGCAGTCCGCACGAGGCTT
CGTCAAAGGGGAAGCCACATCGTCGATAGCACGCCTTGTTGGCCTCGTTGCTCATTGCTATCGTTACGTTGGCGTACGGCTCCGTGCGCAGTTGAAGCGT
GTAGTAATCTGCGTGTGGGTACTTGAGCGTAGAAGCCGCCAGACTCTTCTCGAAGAGAGGAACGAGCGTAGTGGAGTAGGCCATGGCCGTGTCGTCGTTG
tcagcgactgcgacgacaatgtccggcagcaccagcgcatCATAGACGGGGTCCAGACTCTCGGACGTCGCCCGAACAATCGTCAAATGCacgtcctctt
cgtccaggtGGTCGTCGACTGCAAGAACGCGCACCGTCTTGGGCAAACTCCAGTCGCTCGCCGTAAAGAGGAGAACGTCAGGAGAGACCGTGACGTTGCA
CAGCAAGGTGCTCGTACTTGTGCTCTCCGTGTCGACTCCGCAGCTCAGGAACGAGGCGTCCGATTTCACCGCAAACTTCCCGTCCGAGAGCTCAACAGTG
TGCGAAGGACACTGAGGATTGTTCACGCAGCGGCGATAGCAGCCCGAAGCGATGTGGAGCGTCACGCGGACCTGCTCCGTAGGCTCGGAGAGTAAAACCA
CCTGGTAGTCGTTGCCTTTGCCATCTTCCGACACACTCAGCGACGCAGTGGAGAACTCAATGCCCGGCACCGTCAGATCCGTTATCGTCACTAACAAAGG
CGACACTGCGATGGTCTCCGCATATGCGTtggcagcgacagcagttTGTTTCACTGGCTGCTTGGCCCACCCCACGCGTAGGTCCACAAGAGCGTCTTGG
CGTGCTAACTGGTCGCTGGTGCGCTCGAGCACCCGGTAGAGTACAAAATCGCGGTAGAACGCGGTCACGGACTCATCGAGGACCTGCAAGAGCTGCTCTC
CACCTGTAGCTTTGTTAACGCTAGAGGTGCTAGCCTCTGACGTGAGTTGGTACAATGGCGGACTCGAAGCCACGTGGGAAATGACCGAGGAGTGCAAACC
TTCGTACAGTTGGTCATCTGTCGCGAGAACGTGTACGAGTTGGGGCAAGTTCCAGTTCTCTGTCGTGAATACGAGTACCGATGGAATCACGGACACGTTG
CACAGGTTAAAGCGGTAGCACGCGCTCTCCGCGTCGAGTTTCACGGTCactggctgcagcggcttggcAGACAACTGGACCGCGTACGTGTtgtgcgctg
ctgtcgcttcAGTGGACACGCCGTCGAGGAAATCGTGATAGTGGTCCATGATCTCTGTGGTCGTCAACGCTCGCACGAACCACGAGACACTAGCGATAGA
CCCTGCAAAGCCACCGCCATCCGCGTCCGGAGCCCCGAACCGAATCACCTTTTGGGAGAAGCTTAGCAGCGCCATGTTGCACGAAGTCGCACACGTGTAG
CAGGTGgccgtctgcagcgcgcccGACACGCACATGGAGAGCGAAATACTGGACGAAACGGGGTCGTAGCTCGCGACGGCCTGGTGCCAAGCTCCCGCGA
CCGGCAACACGTCGGCGTTTGCCCCCAGCTCTGTCCTGCACACCATCCCGTCGTCTGGGTTTGTCATCTCGAAGTAGAACCGCcccgtgttgctgctgat
tgCCACACTTCCGAAGGTGATCTGGTCACCACTGGCGTCGTTGCCGTACAAGGTGACAGCGTCGACAGGGACATGGCCTGCCACGGCGTCGATGAACGCC
TGGCCAAGGTGCAACCAAAACTCGAGTgagaacgagctcatggcCGGTTGAACcgcgactgcagcagagaAGAACGTGCCTTCCACGGCATCGTCGATCT
TCAAATCGACCGAGGCCGACGTGTTCTTCAGCTCCGATGCGCCGGTAGCACGACTGTTTCCTCCCCACGACGCCCCTGCTTCGTCATTGCTAACCAGCAC
TTTAGGGGCGTCGTCGAATGGCCAGACGGCAACCGGGTTGCCCCTTAACAGCAATGCTCGGTTCTCGTTCACCGACAACGGGAGCCGATCGACGGGCAGT
AACTCGGATTTCCCAAGAACGGCGAGATCGACAAAGTCGCTGAGCACCAAACTGCCTCCAGCTGCGCTTGTGGCGTGAAGAGGAGCTTGGCAGGCCACGT
CCGCACAGACGTAAGCCTGGCACTGCAAGGATGGAGCGAGGACAACACCTGCAGCACTCAACGCGCAGGTTGTTGATGCTCCGTCAGCGGCGAGAGCTTG
CGACGCGGTCTCACTGCggacgccgtccagcacggaGCCGTGGGAAGCAACGGAGAATGCAGTCACAGGTGCCACATTGGCAGTCGAGCAGTGACTCACA
TCCGTATCGACGTCGACCAGTCCAATCTCCACGGGCACGTCAAACTCCAGAACCACCCACTCGTGGTAAGACGGCGCTCTGGCCACGTAGCACGCCGTAG
TGTCCTTCGCGTTCAGTAGTGCGTTCGCCGACCCCGCACCTGTGCTCGCCAGTTGTGAGCTCACGCTGTGAATCTTGCAAGTCAACGGAGCTGCCACGGC
CAGCGTTCCGGAAGTCGTTGGGGCTACATCGCTGGGCGGGAAGACTTGCACGCtagcgacggcgagcggctTCTCCCCCGTCCCGAACAGGTCCAGCAAC
AGATAGCGCGACATGGTGGCCGGGTTCCACCGCACAACTTCCATCTCGTTCAGCATCAAGACGCCGCTCCCTCGCTTTCGCACCGTCACGAAGCGAGCTT
TCACGAACACGTTAGCCCACTCGATCGAGTTCGTGTAGTTGGCACACGAAAACGACAGCGTCTTGCTCGCCGTCACAAGCGCTCCGGATGCAGTGCCATC
ACTTGTCGTCAACGGTAGagcggacagcagcacgtcgaatTGCTGCGCAAACGGAGCTTTCAACTGTAGCAACGAATCCGTGCGACGGTCGTCGTACAGG
TCGCCGCTCCACGCCGGATACCCGTTGCTTCcagctgccgtcgctggttCAGGTGCGCAGAGCTCGACGTAATGACTCCCCACGTACGGATAGAGCACAA
CCGAGCGAACGGGCTTCACGCTGCCCAGATCTACTTCCCACCACGGATCCGTCCCGACGTCCGTCCTCGTACTTCCTGCCGCCATCGTGCTATCACCTTC
ATCCTGGATAAGGAGCGGGTCCCATGTGGAATGTCTTAACCCGTCTACAGCCAAGGAAGAGATCGCATCGCTCGGTTTCGTGCTGCTCTGCCTCGTGGCC
ATTCCACGCGCGAGGTTTTCGTTCTCGGACCTCCTTACCGTCTGCAGGAGACGCCACGGCTGGAGCAGTGCGGGGCTCGGCCCCCAATCGGACTTGAGTC
GAGACCGGATCCCCGCTCCATCCGCGGTGGGTGTCACCGATATAAACGAGTCAAACGCCTGCACCTGTGCGAGTTGCAGCACGCCGGTACCTTGGCGGTA
GATCCGCACTgccactgcaccagcttGAACTTCCCAGAGCAGAATCCCCTTCCGAACTCGCAGTCGCTCCACGTGAGGGCAAGCCCTCGGACAGCCATAC
GCAACGGCTTCATCCAGCGATAGTGCTTTGGAACCGAACGTCTCCAGTGAAGCAATCGCCACGATGTTCACTGCTTCGGAGTCCGCGTTCTTTTCGACAA
CAGAGGCGGGCAGGAAAATGGCCAGCGTTCCCAACTTTGTTAGCCGAGGGAGCGTCACCTCCCACCACGGCTCGCTTTCGCTTGCAGTGGTCGCAACGGC
GACGGTACTGTCGACCGAGTCATCGTACGTGGCCCCGTTGGTGGCAAGTGAGGCGGCTAGAGGTTCGTTGGTTGTCGTCGATACCGCAGTTGAACTCTGC
GTAGCCGCCAACCCGCTCAGCAAATTAGGGAACTCGTAGGACAGAGACAGCAGGGGGCGCAGCTTCCTCTCAAATACCGACGAGCACAGCTGAGTCGTAG
CGATCGACTCGGTACTTCCCCCCTCCGAGAGCACTTCAAGTTGCAGCGAGACCGCGGATAGTCGAGTGGGCACAAGTTGCTTCAGAAGCGGGGAAATGTC
CACCTCGATCGAACGGCTTTTCTCCACGATCGCTGTGATCTCCATGGACGCTCCATTCGTGAGGAACGAGAGCGGTTGGGGCGTTGCCGTTCCTTCACGA
ATACTCTCCGTCGTCCACGCGTTGTCCACTGCTGTCACCTTCAACACGTACTCCCTCGTAAAGCTCACCCCCTCTGACGACGTGTCACCTCCAGTCGAAG
AACTGCTAGCGCTATCCTCTTCCGATGCATTGAAGATCTTGTACGGCGTTTGATGCAGCACTAGAGTGGCCCCCGAGTACGCGAGCGACGTGTCTCCATC
GTGGAGACGCGGGAGATGAAACTTCAtgaacgtcttggcgtcggcaCCGAACACGAGGATGTTCCGGAGTGCCGACTCGATTGTCTTTCCATTTGCGGTT
GTCGTTGACACCGACACGTCGTGGAATGCCAGCGCCGTGACGTAGTCCCCCACCCAACTGGTTGCATCGTTTGCCTCTTTGGTCGCAAGCTTGGCTTGAG
GCTGgttcaccaccacgtcgaccTTCGCGACGTCATTGTCACGAACAAAAGCATTCACGAGCATGTGACCTGGTGAGTGGAGGACGGTCGGCAGAGGGTT
GTAAGGGATTCTCCCCCCACCCACAGCACCCCAGCTAGGGTAAAGCTCGTCCGTAGCTGGCGCGACGGCACCTTGGAACCAAAACGCGGTGGCACTCGTG
TAGCCGTAGACAGAATTCTGTACACGATGCGAAATCGTGAAGCTCACGTTGCGCTCTGCCACCGCATCGTCCACTGCACGCACCGTGACGCGTTGAGGCA
CAAACCAGTTCGTGGCTGTGAACGTTAAGAGCGAAGGAGAAATCGCCACCTGAGAGTTCCCCACGATCGCGATGCTCACGTTCGGCGCGTCAACGCCGCT
CTTGGAGCTCCACGCAGTTTGATCGTAGACCGAAGCAGCCAACGGCGCAAAGTCTTCGCCCCAGAACCCACACGTGTCCGATTGTTTGTGCGTACAATAC
ACCGAAGAGATCTGCGCTTGGTCGCTAGGGCTGACAACCTTTGCGTGGCCTCCgatcgacggcggcgcgttcAACACGACATCGTATGTGGCATTTGTCG
TGTCTCCTTCAGTAACCTCCAACGCAGCAGTAGAAAGCGTCACTGCTGCGTCGTTATCCCAAATGCTTacgtcgacgctgttgcCAGGAAGGAATTTCGC
CATGCCACAGTTCCAAGAATGCCGCTCGAGCGAGTAACTCGTCGGGAACATGGCGAAGGTGGCAGCAAGGACGCGTTCCACGTACCCTGCAGGCCACTCG
TCGAATGCCCAGCGCATGGTCTCTAGTCGCACCAGGCCTGCGCATATCGTGTGCTGCACATTCCTCGGGCTCGCGCTCATTTTCCTCGCTTGCTCAACGT
TCATGAGCCccaggaagctcagcacgaagccCCGCAGCTccggcggcggtggcgtgaACGCCAGCATCGAGTTCGCTGAGGAATCTGACAGAGCCGTAAG
CTCCGAGTCGCTTTTCTCCGCTGCTAGCATGTCCGTTAAGGTCGCGTAGCTCATGTCCGCCCACGTTTCATCGGAGCTTCCAGGGTCCAGCGGTGGGCTT
CCGAATCGAGCTGGGACTGTGTCGCCAGTCGCCACGTCGGTGATGCACGCCCCGTTGCCCTGTGCGAACGCGCACTCGTCCGTGATATCGCACACCCGCA
CAGACGTTTGTccagcgtgcagctcctccttcggCACTAAGCAGACTGCCGAATCCAGAGGATCACAATTGGGCACGTCGAAGCATTGCGGACGCCGAGT
ATGGTATCGGATGTCCTTGCTCTCGCTGTAGTGGAGCAACGGGCCTCCGTCATAGAGCCCGCCGTACTCCACTTCGGACTCGACATCGTCCACGGCACTC
ACGAGTACGCGCTGCGGTTTGTTCCAGTCTCCCGGTTGGAACGTGAGCACTGCCGTGTCGTCTTGCGTCGCTGTGCTCGTTGCTTCAGGGGCTACCGCCG
TTTGGTTAGCATGCAGCGGCTTGATCACGACCTTGACCGGATGCCACGGCCGCGACGTTAGCACGACGTCATAGCTGTCCTTGCCCCCACCTTCGGCAAC
GAACATGTGCTGTCTCGAAAGAGACACCCCAGCGAGGTCGTTGTCGTCGATCTGCACGGTCACGTTACGCCCCGTGAGGAACGGGGTGTCTTGTCCATCA
AAATTCGGGTCGATGCTGGCCACGGAGTGCGTGACAACGGCGTAGTGCCTCCCttcggccagcgcgtcgtccacggctGCCACacgtacgagctgctcgc
ggtTCCAATTCGCAGGCGTGaacacgacgcgctgcggcgtcaagaactcgagctgctgcaccgaTTCGCCACTGGGGTCCAGGAGCCGcacgtcttcagc
ttctaCTACGACGTCCGCGAGCGGCTGCCGGTTAAGCACCACCGCATACTCCGCAACGAGCGCTCCTTCCCGAATACGCCTTCGTCGCGGCGTCAGCGCC
ACGCCACCGTCCATGGCGTAGTCGAGAATATCTCCACCAAAGTTGAGATTCATGGCGAAGTCGTACGCTCGGTTCTGCGCGCTCGCCCGTGCCTTCGGGT
CCATGACCTGCGACTCGTAGTCGGACACCCGGCCCGCGTGCGTGCGGGTCTCTAGAATCTCCGCCACGTCCACTTCCACggtctcgtccagctggtTGGT
GGCGCATCCGccggagagcagcagcgtgtcgaagctgccatCGAGCCCCACCCCGTAAGCAAAATCATTCGCGGTCGTGCCGAACTGCGAGGCAGCAAGT
ACCAAATGAGCAAGAGGCCACCGAACGAGCCCCGAATTCCATTCCTTCGTACCTGACGCGTCCAGAGCTTGTCTCCGGCCAGCGAAACCTTGAGCAGAAC
GACGTCTCGACCGCCGTACTGCCCGAACCCGTTGAGTGCGTGGCCGCCCTCATCCAGGTACCCCCACGTGTATCCTGGCACGTAGAGATACTCTGTCCTT
GCGCCGGTCGCTGCGTCCGTCTCGTTAATAATGGCGATGGAAGTGGCTGCATCTGCCAGGTCCGTCCCCCACTGCATCAAACAGAAACAAAAAGGGGATC
AAACACCTCGTAGGATACGTCTCTCGCCTCTCAAAAAAGCAGCGCGGACCTCTTTGGTCCAGCCGAGAGTTCCGTCCGCGTTGAGGCGCGCTACAAAAAC
GTTGAGCAGGTccacgtccgcgtcgtcgagcgTCTTGGAGCCTGCAAAGTACAAATTCCCGTGCGCGTCCTGCACGCCCTTGCCGGCGATTCGCACGACG
GCGTTGGGCTCATCCTGCTGCCAGTCGAAGGCTTCGTTCGAGAGCATCCACGTCTGCACTTCATCCGGGCTCAAGTCCGCTGCGCCCACGACAGCCAGAa
g