Description :
From Genome Similarity Track
Location :
Scaffold_319:16084- 18591
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap-pug3_contig_319-abinit-gene-0.36Cryptic tubulin
Pytul_var.sporangiiferummaker-pug3_contig_319-snap-gene-0.10Conserved gene of unknown function

Sequence
2507 bases(100 bases per row)
TAGACTCCGGCACAAGTGGAAAAAGGAGCCCAGCGAGATCCGCTGCTGCCAAGTGGTTCATCTCGTCGATCGATACCCTGTACGACGGCAGACCGCTTGA
TGCGAGGTTGCCGATGAGGTTGTCCTGCTGACTTTGCTCTTGAGTCTGGGCTCGCAATAATGCCTTCCAGTATCCGGAAGTACGCAGCAATTCGTCGTTT
TCCTTGTAGATGATGCAGTCGGCATGCTCTTGAAGATGCGCGAGTGTAAACACCGAGTTGTAATTCTGCAGTGGCGTGTCGCCGCATTTCCACGACGGTG
CGACGGATGCTGCCACCAAGTACGCTTTTGGATACGTATCCCGTATGAGCTCCATCAATCGGCATCCGAGTCCCGAACCAGTGCCGCCACCAAGCGAGTG
CATCAGTACGGTGCCCTGGTAGCAATCGGTTGACTCGATCAGCTTCCGTAGCGAGTCCATGGTGAGGTCCACCAATTCGCGCTTGTCCTCATCAAATGGC
GTGAATTTGACCACCGGACGCTGTCGAGACTTTGATGAAGCAATAGTGGTATGCGCTTGTGCCATTGCCGTCTTTGAAGGGATCACATTGCGCCGGAACC
GCTGGAAATTGTACCCCATCGCCCAATTGTTCCCGCGTCCAGACTGCTCGAAATGTACAAATGCAGGCTCATGATGTCGTGGCCATACACGACAGACGCT
GTGCACATCGTCGCTCTCAAGCATCGACCGGATCACTTTGGGCTCGGTATCCACCAGGACACATCGCGCTTTCCTGGACGGGCGAAGAAAGAAATGCTCG
TAGTACAATGACGGTGTCGCTGGCGATGACGCATACACGGCCCGCAATGGGGGTGAGGCCTTCCGGGGTTTTGCGAGTGGTGCACTGAGCCCCTTCCTGT
CTTCGCTATCGTGGTCGTCGTCGCTGCCCACGAGCTGCCAGTACGCCGCGCCGAGTTGGTTGCCGCATTGCCCGACGTGCACAAACGCGCTCATTTTGGC
TCGAATGTTGTCTGATGAATCAAAGTTCGCATGGGAAAAGTTCGTAACCGTTAAGAACCTACCGCAGAAATGCAGATGGCTACACTGGCGCATCCAGAAC
AGTTAAGAACCCTTTGTAAGCAATGGAAGATGGCTACATTTGCCCACCAAAAGCTTCGAATGACCATGTGGCTCAGTCGATCCACTCGAATGCACCAGTC
GTGCTTGCCTCGTCCCCGTTCGTCTCTCTCGCATGCATCAGCAGGCTGTTGCTTGAAAGGTGTGTGCTTGTGAGAGTGCGCTGCACGTTTTGGGGCTGTG
CGTTGTGGAGGCAGGTGATGATTATGGCTGTATTCAGCCATTTCGACCCATTGCTTTGCTTGCAACACCGCGAGGAGAAACTAAAAAAGGAGTACTTTGA
GCGTGGCACAGCGAACGTTGACAGGTGAGTTGCTACTGCTGTTTTTATCGCTGTGTGCTCGTGGAATGCAACAGCGGGTCGGTGTTATTAATAAAAACGG
GGCCACATGGATTAGCACTTGCCTCATATGTTCGTGCTTGCGTAGCCTGCGTGCGCTTCTCTGTTGCTTAGGTTAAGCGGATCTTATCGCACAAGAACGT
AGCAATTTCAGGTGTGGCGCTGGCTGGGTTTGAAGTCACTACAAGTCTGGTGCCCACCACGAACACTGCACTCTAAGGCGCTTAAACGAGCGCCGAGGTG
AAGCTAAACTAAGTGAAGGCGAAGTGAGTGCAAGCGTATATTCAACGCGGGCGATAGAACAAAAGAGTTTAGTAGGCGATGGATGGCGACGTCAAGGTCG
TCGATGCAGCCCCCAGCTCTCCATCAAAGAAAGATATCAGCGTTCAGCCGTTGAATATCACTGATATCGCCCCGTGTGAAAGCAGCAATAATCCGAACAA
CCCTGCTCAGCCAGCAAATAGCTGCACTGCCGATGCAGAACTTGCACCCGATCAGAGCTCAGCCGACATGGAACTCGCGCCACATGAAGTCCCGCGCTTT
GAACCCCTGCGTGTGCAATGGCGATACGGACAAGCCGTGTTTGCGCGGTACAAGAAGACGCCGTACTTTTACTCTGGCAATATCGCGACATACCTCGGCG
CAGGCTTATTCATGGTGGTGTTTGATGACGGCACGTTGAACTATCGCGTGAAGAGGGAGGATATCGTACTGCGTGAATTTACCAGCTCTCTGGAATCACA
GGACGAAGACGAGTCGAGCATACCACCACGAGAATACAGCAGCAGTAGCAGTGATGGTGAGCAGCCATTATCGTCGATGGAAAAGCCCAAATTAACTCCC
TTAAAGCACACCCATCAACACTGGCATTCAAACAGCTCCATCATCCATCAGAACCACATGATGGTCGACTTCTCGATGAATCCACCCAAGCAAATCGCGC
TCAATGGAGGTGGCAGCGATGCGGTCGCGAACGAAGCGCTTTCAATGAAACGATTAGAATGCGGAGTCGGGTACGAAGACGACTCGACCCAAGTCAGCGA
TTCCGAT