Description :
From Genome Similarity Track
Location :
Scaffold_18:160825- 161967
Sequence
1142 bases(100 bases per row)
TTTCCACTGGAGGGGACTATTCAAGAGCGTACATTGATATGTCAGTGAATGTGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAATTGAAGGCGAGTCA
CCTGGGAATGTCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCACATCCCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATCG
GGGTGGCGCTGTTTACCGGATACGTGATAGCCAAAGCTAGTGCGTCTAGAACTGCACAAACCATTGCCGAATCGTACGAGAGGTGCGTTTTCCGAAGTTT
TGGAGCTAGTGAGATGATTAGACATGATCGGGAGCCAGGTTTTATGTCTGATTTCTTTCGAGCTTTCAACCGGATCCTGGGGCAGAGACAGCGGGCAACC
ATGGCATATCGTCCCCAAGCTAGCGGATCGGCCGAGCGCATGGTGCAGACGATCACGAGGGCACTCAAGATGTATGTCCAGGATTTGGTCCAGACGGATT
GGGATGAGTACGCAGAACGACCCCCCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGACACCCCATTTTACTTGGTACATGGGTGGGATCCTTA
ATCCACCCTAGAAGCAGCCATTCCGGTATGTAGCACCAAGAAGAGAAACCGAGATCCCAGACGATGGCGATACCAAGTCCAGAAATACTACCGGCAAGCC
AGATCCCAGGTGAACGAACGGCTGCGGAGTGCGATACAAGATCGAGCGGATCGACACAACGAGGACGCCCGTCCACATCAAATCCAAGTGGGATCGCAGG
TGTGGCTTTATTTGGATCGGGTGAAGGGAGGGTATGCCCGCAAATTGGCCCATCTATAGCACGGACCGTTTCGGGTGAGCGAAAAGATAGGGGAACATGC
GGTGAAGTTGGAAACGGCAGGTACCGAATATCGCTTGTTCCCGGTAGTACACGTATCCAAGCTGAAGTTGGTCAAGGAATAGCCGGACCGGCCGCAAACT
CGTCTTTCGGTGGATGAATCCGACCGGGTGGATTTCGACGAAGTCCTCCTACCGGAAGATAGTTGGAATGTGGATCACGAAGCTGACGAGGTGTACGCTG
AAAGGGTGGATCCAGCCCAGATCCAGGTGTACACTGAAAGGG