Description :
From Genome Similarity Track
Location :
scaffold_1204:1608- 2672
Transcript NameFunction/comments
g11161.t1hypothetical protein

Sequence
1064 bases(100 bases per row)
CAAAAATGGATGCTGCAACAGACCGCCTTCTCCATCAATTGGCGGTCGGAGACGATGATCCCGCTCCAAACAGGAGCGAATCACATCTTCCAGGTCCTTG
TTCTGCAACGGCGGAAATGGGATCGGAACTGAAGGATCAATGATGCAACGGAACTTCTCGATGATGCTGGGAACGTCGGCGAACGGGGGCTTCGAGTACA
CGATTTGGTAGAGAATGCACCCCAACGACCAAATATCACTTGCGCGCCCAACCTAGAATCACAATAACAGTGTTGGCTTGTTTGTTTACACTTCGCGATG
CATAGTAGACGTCAGACGTACCTTCATTTTCCCCTCAGGGTCACGCTGACCGTTAGGTGCTGTGTTTCCCTGAATCGCCTCCGGGGACATGAAATTGACG
GTACCAATCTGGCTGTCACGCTCGATGTTCGTCGTGTCGTTCGAAATTGTCTTTGCGATTCCAAAGTCAATCAATTTCAGCGCACCGTTCACAAACAAGA
AGTTGGCTGGTTTCAAATCGCCTAGAACGACAGAAGCATACACACACAAGTAAGCACGGCAACACTCATCACATTTACTATGGGTTGCTTCGATCGTACC
GTGAATAATCCGCTTATGATGAATGGCGTTCACAGCTTTAAGCATTTGAGACCAAATCACTCGCAGCATATTCTCGTCCATGTCACCCTTCAAGGCGCTA
AGCCGCTCGCTAAGGTCGATTTCGCCGTGCTCCATTATCTAACGCGCGATCACAAAAGGAGTCAATCAGATATCCACGCATATACAGTACCATAAAGATC
AAGCAAGGACATACCACATTGATCTGTCGTTGTTGGAGGTCTTGCTCAGCAGCAATAAGCCTGATGATGTGCGGGTTTCCTTGCAATTTCTTCAGAAGAT
TGATCTCATTAGTATACTGGGCAATGCTTTGCGCATCCAGCTTTTTCAATTTGATTTTCTTCAGCGCGTAAATCTTGAGGTCTGGTCCCAGCATTCGGTA
GACTTTACTGCTTCCACCACTTCCGATCTGCTCCAGCTTAATGTACCTCTGCCCATTGATCTAC