Description :
From Genome Similarity Track
Location :
Scaffold_4:1607829- 1618068
Transcript NameFunction/comments
Phyin_T30-4PITG_03402Putative uncharacterized protein
Phyin_T30-4PITG_03403Putative uncharacterized protein
Phyin_T30-4PITG_03404Putative uncharacterized protein
Phyin_T30-4PITG_03405Putative uncharacterized protein
Phyin_T30-4PITG_03406Putative uncharacterized protein
Phyin_T30-4PITG_03407Putative uncharacterized protein

Sequence
10239 bases(100 bases per row)
GATCTGCCAGCAGTAATGCCAACAGAGACCTATCAACGCCAGTTGCACTGCGACACAGAGAGCTGTGTGAATTTTATAACAAGACGTCTCCGCAATCCAG
ATGAACAGGAGGCACCGTCGTCGTTAGGTGAAACCCTGAGCTACCTGCAGTCTCCAGGCAGAATCCTTTATTGCTATCTAACAAGGTACTGGTGGGCCGC
CATGGCAAGAAACTGCGAAAACCCTCCAAAGGCTTCGCCAAAGTGGGCAGCGACTGATATCGGCAATGTTGCCGATATCAGTTGCCTTTTGGAGGGTTTT
GTGATGGGTCCTGCTCTAAGATCGCTGTCGAATTTGACGCCGAAAAACGAGCTCTTATCCAGGTTCTAAGGTTTTCGGACACCTGATTGGCCCAGCATGA
AAATTGATATTGAACTTAGTGCATCGCGATGGACTTGAGCCATGTAGCTGGCGCCGCCATCGAGGTGTAATACGTTGGCTAAGGCACGATGAACCCCAAG
GCTGTGCGGGTTAAAGCCTCTGCATTGCCGAGTTGAGCTGACTGGGAGAGACAGTCGACTGTTTTTGCCTCTACCGCTTGGCGGGCCGATGCGATTTGCT
CGGCAATTTTGCAGTTTAACAGCGCTTGTGGGCGCCTGCTGTAGCGGGCTCGACATGTTACACTGGAAGCCAGCTGAACAGTGCAAAGGGTAAAGTCAAC
TCGAACTTTAGTGGTCGAAGGTCTCAGAGCTTTGGTGTGGACGAAGCAGCTTGTGCTGGCTTCTCCTCTCCCCCGTTGCCTTCGAGCTCGTTCCATTCTC
CAACTTGCTCTCGACCCGGTCGGAATCGCCCTAACTTCTGAGTGGGCATTTCGTTTCCCCTCTGGCAATCCACAAAAAGAAGTTTCGCCAATCGTGGATA
GCGTCAGGAGCAACACGTAGTGCGAAGGAGCAACGAGTACGTAAACGAAACTGAGCCTCGTCGCCACCAACTGCAAGCAGCGCGAGCTGCTCCGTCTCTC
ACCGGTGAAGACCTCGGCAACTCAAAGTCTCTTCGCTGGTACAATCCCAAGTACTCCGTTTCATCTTCTGGACAGCTCCTCACTTGGCAATTGGCCCTTC
AAGCGCCACTTAGCGCCAACAGGCAGTCGCTAAAGTGCGATCCCACAGATTAGCGAAACACACAACAACAACCGTCAGCAAATTCCAAAGAACGACGCAA
ATCCACTTCCAGCACCTGACCGAGTTGCAATGCCACTTTCCATCTCGTTTTACCACAACAAACGCAGCGAAAACGCGGCCAGCTCCTACCAGAGTGTGGC
ACTACACGATCGAGAGAAGGTGAAGCATAAAATGGCGTTACCCTGCGAGTTCTACCGCAACATTTGGGGGCCAACGGAGGATGAAGACGCAGCGCAACGC
CGTCGCGCTCGATCAACCAAGTCTGGCCGCTCCCCAGCGTCGGTAGCGTCGCGCAAGTTCAAGAAGCGCGTGGCAACGGGCCCTCTTGTCGACATCGCCC
AGGTGGCGCATGTGGTAACGACAATGTCGGACTTCCGCGCCGACTACGGTGAGGATTCCAAGAAGGTGAGACTCGTCAACATTTGGGACGACCGCAGTCT
AGCATTAGGATTAGACTCAGGCTCCGCCAAGTCGACTGGCAGCAGTGCCGACAGCAAAGGTCCTTCAACTGCTGATACCGAGCCAGAGGAAATGATGTCC
CCTATTAGCAGTCGAGCAGGTCGGATCACGGAGCTCAGTTGCGAAGACAGCGACGATGATCTAAGCAGCTTAGCGTCCTCGTTGGTGAACCGGCAACGAC
CAGGCGAGCTGAAACGAGCACAGACACCCGAGATTATCTTCCCAAATGCCAAGAAAACCAACCAAGGACGTGGCAAAGACAGTGGCAAGTTGAACAGGAA
GGAGCTCAACTTCACAAACTTGCCAGTTCCCCCTCCATCGTCACACAATGGCAGTATCATTTTTAGTGCCGTATTCTCTGAACAACGGGAGTGGAGTTGG
AGCGCCAAGTTCCTCTTGGGGATTCACGAACCGATTCGGCATGCTCTATTCGTCATGGATCGGTTCTTGGAACAGTCTCAGAGCCAGTCCAAGCCTATGG
CTTCGCACACATTGGCTCTAGAGTCCCACGTGGCAGAGTTTTTCCTCTGGTTCAAGACGTACTTCGTCGAGTATTTGCTGTGCCAACACGACGTTAAGGC
AGCCGTATTGCTGCCAATGCTCAACTTGCCAGTGTCGACTAAGCAGCAAATTCTGGATGTGTACCAGGACATCAAACAAATGCTGGCTCAAATACAGCAG
CTCGAGCGTGCGCTGTGTGTCAGTGGAGCTTGCAGTGCCTCCTCATGGCTACTGCGGCTTCAAGTACTGCAAACCGAAATCAGACAGCTAAACCGTACGC
TACACTCAGCGTTGAACATGGAGGAGACAACGTTGCATGCAGCTATGAGCGCTGCATTCACTGAGCGCGCATTCCAAAGCCACATTATGCCTCGCATATT
TCGCGCCATCCGAGCCAAACGTGTTGTGGTGCCGTGGATTGTTGAACGCAGCAAGATTTGGGGAGGAGAAACCGAGCAGCGCAGTATCCAGGGCATGCTA
CCGTTCTCAGCAAAGTTCATGTACCGCAAGATATGGCGACCGTATTTCATGAGCAACGTGGCAGTGGCGATGAAAAATCTCAACGAATTTGTCTGCTCAT
CAGATTCGAGCGGAAGCGCCAGCAGTGGCTCGACATACAGCGAACGCAATGGGGAAATGTGCTCCATCATGTGAAGCAGCAGCGAGGTGGCAGTCTTTTG
TTAACTTTTTCTTGAAAGCTCGATAGCTATTTATTATGGACCAACATCATCCATTTCGAACTTGTGTCGTGGCGTCACCTGAGCTAGCAGAGCAAATAGC
CTGAGCAGCGAGTAGAAGCCTCATAAGTAATAAAAGCGCTTTCAAAATCGTTGGCTTTGTGTTTTTTTTGTCATGAAGGCACTCTGCAATGATGAACGTT
GGTTTTGCAAACGCCTCGATCGCTGCATTAAACGAGAACGTGGATAGTAAATGCGAAACTACTTTAAAGTGGCTGGCAAATCCGAACTCTGTCAGTTTCT
AAAGAACGACCCATCAGTGGCCATTGTCGTACGTCGAAGGCCCACTGTAAACGAAGGCACCTTAAAACCCACAAACCAAAAGTAGCGGGGTAACAGCATG
ACAGCAAACGAGCGAGTTCAAGGTAAGAATGAGATCAATCAAGATGCCGAGCAACAAGCGATTGGCGTCGCGAAGACGATCGACCAGGACAACGATTCCC
AATCACCCTCTGTCTATTCCGACATGCCTCGACTTGCATGGGATTGGATACGCTGGTCTGGTGCCAAAACGTTCGATGGGATGGATTTTGCCGGTGAGGT
GCTAGCGAACTTCCTAGGACTCAATCAATCCAAGTACCAATGGATCATCGCTGCTCAAGAGCGTGAAGAGGAGGAAAAACAGCAGCGGCGCCTTGAAAAG
CGTCAGCGACGTCAACTTCGTCTGGAGCAGTTATTAGAGGCAGAGCAGCGCAAGCTTCAGGAGCTTGAACTAGGTGCTCGTGAGCAGGATGCAGTGCTAT
TAGATACACCCGCTACGATGTAGGAGCAACACGTAAGTGTTGAACTCGTGTTGGTTTCTGGTTTTTGTATCTGAGATGCAAAATTCTTCTTGACAGCAGC
AAAAATTCACAGTATCTATTCGTCGACCTGGGTATCGATGCTATCCCATAACGGATGTGTTGGTGGCTTCACTCCAGCGCGTATCAGCATTCGCACAGCT
GTCTTTTCGATGCGTTGCAGCTGTCGGTTCACAACACTTTCACTCTCGGGCGTGAACTGTTCCGTTCGAATCGTTAGTATCCCTGCACGATATTAGGAAG
CAAAGAGTCACACCCTTGTCAATCACCGATGTGTCTGTCATTTATAAATCTCACCATTAAGGTTGCCAAAGAGGACATCCGTCGAGTACCGGTCGCCAAT
CACCACAAGTGTTTGCGGATCTACTTCACCAAAGTGTTTCTTCACGAATGCAATGCCTCCTGGTTTCTGCGATATTAAATATTTACATGTGAGCCCCACA
GTAGTTGTAACCCAACAATTCAGCGCAAAAAAGAAGAATACCTTTTGATTGTGACGAAGTACCGCAACTTGTAGCTCCTCTTCTATCTTCTTGGCTTCTA
TTCCGTCTTTGTCGTCCGTTGATCCGGCCGAGTTGGAGAAAATTACGATGCTAGAGTCTCCGAAAACACGGCGACATTCAGCCAGAGACGGCGCCAAATG
CGGAGAAATCTCCAGTTTGTGGGGCACAGTTAATGTATTATCCTTGTCAAAGATAACACAACGGAACCCGCGGTCTCGCAGTGTCTGGAACGGCACCTCC
GTCACATCTGAAACGCAGGGAGGACAGATGCACGTGAAGAGCATCAACGTAAGTGATTTATTCTGTAATGAACATTAAAACTCTGCCCACAGAAATAAAA
GTAATGGCGTTGATTACCTTTCACAGAGAGCTGCGGCAGCAAAAGCTGCGGTTGGCGCGTTAGCACGCGGCAGAACTCCACAACGCCACCAAGATTGAGG
CCTTTCATGCCGCTAATACTAGTAACAATGGTTCACATTTCCATCAATCAATGCTAACTTTGAACAGCTTTTTCAACCAATCCAAACGCGATTCGGTTTC
AGCAGCCAGTGACGAGCTCAAAAACACTTTGGCGTCGCCGACACTAAGCTTTTGGTGTGCTTGCTCCCTGCGCTGACGGCCTCGCAGTGCAGGACTACTC
GGATAGGCTCACCATATATGCTCGCTGCCCTTTCTACCCTGTAACTCTTTAAAATGGCCGAAAACCAGCAAGAAACGCACATCCATGACGAGGAGGACAA
AGCCGAGAACTCGAGCTCCGACGATGACTCCTCCTCCTCCAGCTCGGGCTCCTCCTCCTCCTCTTCATCATCTGATTCAGAATCAGAAGACGAAGCGGAG
ACCGGGAATGCCAATGCAGACGCCAACTCGACAACCACACACGCCACTCCACCAAGCGGCCGCTCGGGCCACGGCCACCCCAGCAACTCATCGGGACCGG
CACTGTCTGCCCCTCGGCCCCATGGGATGGCATCCAATACAGAGACGTTAAATGTTAATTCGACGCGAGCAGCGGCCAGGTTTAAAGCTGCAGAGCCAGA
GGCGATGATGGCTCTGGGCACCCGCAAGCGAGACCGACGTACCATTGAGGAGATCCAGAGGGACCTTAGGGACAAGAGGAAGAAACCTCTACGTACACCA
GCAGCGAAGTCGAGCCCCCCGCCTCCTCGAGGTTCGCCAGTGCGGTCTCCGGAAGCTGAAGCGGTCGTCAACAGTGGAGCCCCGATGGCTGTTGGAGGCC
CTCTAGGTACCTTTCGAACAGCAGGACGACTGCCAGCAAAGAGGAAACCAAAGTCGGCTCATGACAGATTGGCTATGAAGCTTAACGGACGAAAAACGTC
AAGTGCAAAGGCGAAAAAGTCGACCAACTCGACTGCTGGAAGCGGAACAGTGACTCCCGTGTCAGTGATGACGAACAAAACGGTGACAAAACCCATGACA
GCCGCAAGTTCGATGGGTATGGCAACAGGGAACAGTAGCAGCAGTGAGCATGGAGGTGACGCTGGAGGTGACGGGTACAGTAGCAGTGTTAGCAGGTCAT
CAACTCCTGCGGTAGACGGCAAAGTGGTGCGTGCGATGCTGCGTGCGATGCTTCGCTACGGAGACCTGACCGACGTGGATCTTTACCCGACAGCTGCCAA
TTTCGCTGACGAGTACAAGATGCCTAACTTCATCGAGCGCGCGAACCTTCAGACTACCACCAAGATCTCCATCGATCGTCTGCAAACTCTTGCCAACGAA
GTTGCTCAGAAAGCGAAGCAGGCGGTCGAGGCACGGCCACCGCACGACAGCATAAAGATCGCCGAGGTTGAGGCGAAATCGTCACAGATTATCGAGCGCC
TTTACGAAAATCTAAAACTCCGCGTCGCTGTTCAACGCGCCCTGCGTACTGCTAGATGCACTTCGGGTAATGCCCTAGCGAATGCTCAAGGCGCCTATGT
ATTAGTGGCAAAACAGAGTGATCTCTCAGTTCTGGGTGTCAATACGCGAGATTTGCCTGGCTGGACCTGGGCTGAAAAAGAGCATGACTGGTCACAACGT
AAAGATGCAGCGCTGCTTCTCGGTGTCTACGTACACGGGTTTGGAGGCTGGGAAGATATTCTAAACGATGATTTACTTCAATTCCAGGGACAGCGCGCTT
TAAAAGGCGAGCGTCTGAAGAAACGTGCGGAGAACTTGCTGAAGCGATTGCCCCCTCCTGATCTTGATGCTGGCGACCCGCGCATTGTGCAACAAGCGAG
CTCACTTAGCTCGTCCGGGGGTAATTCGAACCAATCGTTAGGGGCGCAATTCAGTGCTATTATCCACAGCGGGACCATTCCTGGGGTGACAGCATCAATT
CCAGCTAACTCCGCAACAGCAGGGGGTCGAATGGCCCGTGCAGCTGAACGATTCGCTGCACGGCAACAGAATGGCGAAGATGTTGTGGGGCGACGTCCAA
TTGGGTCTAGCAATGGGACAGGGCCTTCTAATGGCCAGGCAACGGACTCAGGAAGACAACAGAGAACTCCTCCGATGAGATCTCCAGCTCAAGTCAGTGT
GGTTGACAACGAACCCGAAGAGGGAGAAGTTGGCGGTGCCTCTCCAGCACAATCGACGTCGTCTCGACACAAGAGGAGATCGTCATCCGTGGAGGATGAA
AACCAAACTTCGTCCCGTAAGAAGCATCGCAATAACAGCATTAAAAGTTCGAGCAAGAAAGAAAAACGGAAAAAAGAGCATCGACGCAGTGACCGTAGTG
ACACGAAGACCGATGAGACGTCTGCCGTGACAAATTCTGTTAGCGTGGCACCATTGCCGCTGCTGTCGACCGATGAATGCTACGAGAAGTGGAAACCTAA
CAAGAAGCTGCGCGAGATTCGACAAGTGCTGAAAAAGATGAAAATTATGGCCGAATGGTCTCGCAACCAAAAAGACGAGACTGTTGTTGAGAAGGTGTTC
AAGTATGTGAGTACAATTGGCGAAGCGATCGATCGCATCGTCACACAGCACGAGGACAAGCCTGAAGACCATCGTCCAGATACGTCATCTCGCGAAGTTG
ACGAGCTCTGTACGTGTCTATGGACATACGCCGCTGGTTTCACTCCGTTCACACCACAGGGATTCGAGCGGCTCTATGATGATATTTGCGCGGATGGTGA
AGCTCTTGTTGCAACTAAATCATAGCCTCACATTGCAGGAAGATACGTGCATAGATTCGGGGGAAAAAGTTTTAGCAAAAAAAATGAACGACATACACTC
CTGACCTACACTCTTGACTTTGTGAAACGGCCACCCGGTCTGCACCGAGTAGTTGCAATCTGTTATCGAAAATGTTGCACGAGTTGCAGCCCCCGCCCAC
GCCGGAGGAGCTGGCGTTGAAGGAACAGGTTACACAGGTGCTGGCAAGTCAAGGTGTTCTTGCCAAACTAAAGGCAGAACTTCGTGCCGCGGTCTTCGAG
GTTATGCACGAGCGCGAGGGATTCGTAAAAACAAACAACGCTCCAAAACTCGGCGACTTCCCGATGGAGATTCGGACTACGGCGTTATCTTTAATTGTTG
AATGTATGCGATTTTTCCATTGGGAGCACGCGCTGCGGGTACTGCTTGCAGAGACCAACGCAGAAAATGTGCAGCAAGATGACGCATTGCTGGCAAAGAA
GCTTGGACTAGAAAGCTCAGGATCCTCAAACAAGCCAACGCTTTTTCAGCTCATCGAGTCCAAGGTAGGAAGCCCAGACAAGGGTACAACGCTTGCTGCA
ACATTGATTTCTACGCACCATAATGATTTCGATGAAGAAGATGACGAAATTCGTCCGCCAACACATTCGTGGGAGCCAAAAACAAAAAATTTTGGCTCTG
AAGAGAAGGATGTTTACCAATCCCCTACGATAGATATCAAACACACAGCCCCAGCAACGAAGGATGAAGCCAAAGTTGAAGATGCGGAAAGCAGCGTAGA
GATTGAAGAGAGCATGATGGAAGAGGTTCCTAGTGGATCCGAACTGGAAGAATCGAACTTTACAAATTATGAAGATGATGGAAGCCAAGATCAAAATGCC
AAAAGCACCAAACAAGCCACCACACTCAACCCGAAGCAACTACAAGAAGCTGAAAACCTCGATAAAGCTCTGAAAGAAAGTCACGAAAATGACAACAGCG
ACAATGGTTCTGAAGACATGTTACCAGTGGCAGCACCCCCTCCGGCACCGGCAAAATTGCCAACATTACCCCCGTTGGTTGCAGTACAGAGCAATGCTCT
CGCTGAGGATACAGAGGATGAGTTTGATGCTGTTAGAAATGCTCTCGTTGAGGATGCAGAGGATGACTTTGATGCTGTAAGCAGTGCTCTCGCTGAGGAA
ACAGAGGATGACTTTGATGCTGTAAGCAATGCCCTCGCTGAGGATGCAGAGGATGACTTTGACGCTGTAAGCAATGCCCTCGCTGAGGATGCAGAGGATG
ACTTTGACGCTGTAAGCAATGCTCTCGCTGAGGATGCAAATGATGACTTTGATGCTGTAAGCAATGCTCTCGTTCAGGATGCAGAGGATGACTTTGATGC
TGTAAGCTCTTTCATTGGGATAACTCCGTGTTTTTATTTTAATTTTAATCTGCATATTTTGACGTAGGAGGAGGAGGCTGAGCGATTAAGAAAGTTAGAT
GCTGCGTTGCGAGCCATGGAGGCTGAAGATGATACAGGTACACTTCAGCAACTGAAAGCGTCTTTGCAAATGGAATTGCAAGAGCAGGACAACCTTATGA
GCAGTGGAGGCAAAGTGGAAGGCAGCGATGGCGAAGAGGAAACAAGGACGGGTTTTAAGGAGGAACAGGACGATGATGAAGGATACGGCAGCAGCGACTT
CGAGGAGGACGAAGAAATTGCCAGGTAAGAAAAATGTATGCAGCTTTTTTCTCCCCTTGACGATACTCACAGGAAGGTGTTTGTACTGTTTCAGTAGTGA
TATTTCGGAGGAAATGGAATCCATGCCAGAGCTCTCGGACAAGGAGGACGAAAGTGACGACGGAGCAGCTGTGTCAGCAGCAGCAGAGCCGCCACAAGTG
CTTCGAAATGATACCCGGGTTGACAGTGAAGATGCTTTGAACAGCTACGACTACATTGAAGACGTTGAAAAGGGTGGGTGGTGAAGCATTCAGCGAAGAA
CAGAGCAACAGGTAGAGTAGTTTTTCCACTCCAAACTGTATTCTAGTGGCCGCTGGCATCGTTTAGCCAGCCAAACATGCGTCTGTGAATCTACTTGCGC
TTTCCTGAGCCCATCAGTTTGTTCAGCAGGTTTTGGTTATCGAAAGCCTCTGGGTGGATGAAGTAGTGACGGCCACGAGCCTGGAACGAGATCATCGGGT
GCATCGCCTGTGTAGGAGGAGTGACACTGGACAGTCGGAACGAGTGCTGCTCCAGCTGAGCAAACAACGTCGTCGTCTCGACTGTCACAGTCGGGTCATC
TTTTGTATCTGCAACGGACGCCTGATTAGGGCCAGCAGATGTATTTGCCAGCCACATCCGCATCACATACGGCTTGAACAGGTAGTGAAAGAGTGAGGTG
GAGCCAAAACCGAACAGCATGATGGTGCCGCACATTGCCCACTGCAGAGCGAAGGTAACAACAAAATATAACCAGCGTCAGTACCGTGCCGGGAACTAAG
GTTTACAGCCTTTTGACTATTGTCTACTAACCTTGCCGACAGAGGACGCGTCTTGCTCACTGAGCACACAGAGCACGGGCATTCCGATGGACGTGAGAGT
GCAGCTGGTGACCGACACGGCTTTCATGAGGCGCACAGCGCGCGTCATGGGCGCCTGGTACACAAGATCTCCGACTAAATTCTCCCCATTTTGAAGTGGA
TTGTTTGCCTTATCCTCTCGAGCCTCGTCATCAGACTGAGACGAGCTGAAGTGCCGAATACAGAACTGTTTTTTAAGCTCAGCACTGCAACGGCTGCTGA
AGTCAAACGATGCTCCTTGGATCACAGCTGTTTTGCTAGTACGAACGGCGGCCCGGGAAGCTGAGCGCAGAGAGGAAAGCTGCCTTGGGAACACCTCCAC
GAGAGGCCCTGCACGGCGTGATGTCCGCAGCATGAACAT