Description :
From Genome Similarity Track
Location :
Scaffold_461:16078- 17624
Transcript NameFunction/comments
Phyta_totarag8505hypothetical protein PHYSODRAFT_346416
Phyta_totarag8506hypothetical protein PHYSODRAFT_504002

Sequence
1546 bases(100 bases per row)
AAAATCCCCATCTCAATCTGCTACTGTAGCCCTCTAGGCCAGTAACAGTGACATGCTACACGCGAGGGTCATGATAAGGTGAAAAGGATATTTCTTCCGA
TGATGGCGTCCGACATCTGCGCGAATCGCGATTGCTGCATGCAACACAACACAAAACCAACACTTGTCAGCAATTGCAACTCAGTCCAAAGACTGCAGTC
GACAGTAGACCATAGCGACTACCACGCACCATTTGCTCCAGCAGACTTTGCACCTATTGTAGCAAAAAAACCACCGTCACAGCACACTCAGGATCAATGT
AAATTGTACTGACAATACTGGGTATCATCCGGCTGAACACGTACGAAAACCGTGAGGTCCTGGGCGTCCGTGGGTCCGCCGGCAGGAGCACTGGAGGCGC
TGCCGTTCTTCGATGCGTCTGAGGAGCTCTACGAGGCGGAGAAGCGCGTTAGTACATCCCAAGACCATCATCATACACATGCACTCCCCACAGTTCCGCA
ATACGTCGCAGTCCTAGCGCACGAGCCGCCGGAAGACGTACCATTTCCTGTCTGATCTTCTGTGGGTTTCTGGAATCAGTGCGTTCTCGAAAAGGCATAT
TTATTCGTTTTGATAGTTTTGTTTATCAGATCTGATTCTATAGTGAAGTTTGGCAAATCAGGCACAGATGCCACTGCCCAGTCCCAAATTCGCCAGCTGA
AGAACAAGTCTCCAAGTCTCACAAGCGTCACCATGGGGTGGACTTGTGTACAGTGCACGTTCCTGAACGCCAACGACTCGGCCGGTAACTGCGGATCCTG
CAACGCCATCCGCGTGCTGCAGTGCCCCACGTGCAAGGGCGAGATCAAGTCCGTCGTCTCTCTCTTACTCTCTCGCTTAGGATCCCTGTGCATTTCTCAT
CTTCTAATTTATTGCTGCAGATATGGCAAGCGTCTCCATGTGAATGGCAAAACCTACCATCCTgactgcttctgctgcacggACTGCAAACGTCCGCTGC
CGAGTCGCTTCCAAGTGGTGAATGGCGGCAACTATCACCCTGAATGTGTACCCAAACCCAAGTCCACCACCaagacgaccaccacgaccagaTCGTCggg
cggcggtggcagcaagCCAGCGCAGAACGAgaaccgcagcagcaaagcaaaCGTCAAGGCTAATGGCAGTGCTAATACCGCTAACGGTGCGGGCTGGCAC
TGCTCCACCTGCACATTTTTTAATGCCAACGATGCAGCACCGACCTGTGGAGCTTGCGATGCTGTCCGCATCATGCAGTGTCCTGGTTGCAATCGAGAGA
TCAAGTAAGTTTGATGCAGTTTTATTGTGGGTGGGTACTGTTCGATGACTAGCAATTTGTTGGGTGTCAGATTTGGACCACGCGTCAATTTGAACGGCAA
AGCATACCACCCGGATTGCTTCCGTTGCACTGCGTGCAATGAAAAGTTCCCGACGAACAAGTTCCAAGTCAAGGACGGCGAGTACTACCACCATGAGTGC
TacaagcagctcttccaccCACGGTAAGTGGCTTTCAGAGTGTGTA