Description :
From Genome Similarity Track
Location :
Scaffold_50:160701- 164782
Transcript NameFunction/comments
Physo_137010hypothetical protein
Physo_137011hypothetical protein
Physo_108992hypothetical protein

Sequence
4081 bases(100 bases per row)
TCAGCGGTAGACGTTGAAGTGGTCCGGGTGCAAGGTCAGGACGATGGCTCGCTGCCGCACACGAGCAGGCACGGAGGTCTTCATTCCTGAACTTGCAGCC
TGCGGAGGAAGCCGCTCGCCGCCCCGACCTCGCCCGCCCCGCCCAGCCCCCGCCTCAACTTCATGCGCGCGTCGTCGCCGCTGCACCCGCTGGACGTGGC
GCCCGCCGCCGCCGCCGCCTCATCTTCCGCCGGCGCCGAAGCTCTCGGCAACGTGGTGTCTGGCGCCTCGGCCGCCACCTTCCTGTCCTCCGCCTCCGCC
GCCATGCGCCGCAGCCCGAGCTGCGAGTGGCGCGAGTGGGAAGAGACGCTTGACTGCTTCGGCGCCACCGCGGGCCTCGCGGGCATGGACGCCGCCATGG
ACGTGGATCTGGACCAGTTCCTGCTGGCCTCGGCCGACGACTTCCTCGAGCCCTTCGCGAGCCCCAACGCCACGCCGGACTCGCCCATCTTCACATCCAA
CCACGAGTTTTTCTACGAGACAGAGCAGGACTTGCACATGTTGCAGGCCGCGGGCTTCGATCCGCACGTCGGCGGAACTGGCGCTGGTGCCGCTGGAGAG
CTGCAGACGCTCGTGGAGTGCAAACTGGAGCCGCAGCCGCTGCAGCAGCAGCAGCACACGCTGCAGAAGATGCCGACGCCCACAGCCCACCGCCACCGCA
AGAGAAAGACGGCCGAGCTGCACCGCATGAGGGGGGAAGCAGACAGACTTGCAGGGGGGAACGCCCACGTGGGGAAGAAGGCGAAGAGACAGGAGCAGCA
GATCGCAGCCGTGAAGAAGGAGATGGAGGCCAACGAGCAGGCGGAGAAGATCTACCGACGGAGATACGACATCCTGCACGGCATCTTGGAGGCCTGGAAC
ACAGGAGGCATCGAGGACCTCGAGGAGATCGCAGACAACGTGTACGACGAGGATGTGACGCTCATCAGCCCGGACTACTCGGAGGGGCTGCACGGCGTGG
AGGCTGTGATGTCGCACTGGAACATGCTGCTGGACGCGTTCCCGGACGGGATCATGGAGGAGTACATCATCCAGCGAGAGGAAGGCAGCACGGAGAAGAT
GAAGGCCACGTGGACCTTCAGCGGCACACAGATCTTCCCGATCTTCGGCGTCGAGCCCCGTCACAAGAAGGTGTGCATCAGCGGCAAGTCCTTCTTCACG
TTCAAGGGCGACAGGATCCGGCAGATGGTGCTGTCGTGGAACTACCGCGAGACGCTGCTCAAGCTCATGGACGTACAGCCCGACAAGGCCAACAGCGTCG
TGCTCAGCGCGTCAGCCTCCCATGCAACGGCGCAAGCTGGCGGTGTACGATCATGAACATATCCAGCGTGCTGGTTGATTGTACGTAACGAAATTAGCGC
TAGGACGAGACAGGCTGTGTGGTGCACCAGCAACGACGAGCTCGCTCATAGCCTCACCCTAAGTAATAATTATCTATCCCCTCTGTGGTGGGCATTACAA
GCACCGGAACCGAAGACAGTTTTTCTGTTCGAAGAGCTTTCGCTTTGAGTTGATTAACATGATCACTCACCCTCATGTAGTTTGTTGGAGGAGGTAAATG
CGTCCAGGAATTGGTTCGCCACTTTCCTTGCGCACACTGATATCTTGCTTAACAGCGATGTTGAAGCTCATGCGACTAGCGAGAGTCACGATGTACTCAT
GCGAGTGCTGGAACCGCCCTGACGGAGCTAAACGATAGCCGACCGAGTTATCCTCAGAGTTGTCGATGATGCCTTGAGGCAACAGCTCAATCGAGAAGGC
CATCCACCCGGTGGAAGCACGGAGCTTGCGGGCACTCAACTCGAATACTTGCTCCAATGCGCCCACATATATCCAGACATCAGCCGAGATGATCAGGTCC
AAGGATTCGTCGGCGCACGACTCCAGGAACGGCACGATATCCGCCGCTGTACAGTACAAGAAACAACAGCAACACAGCATCAGAGGGCGGCCCCAAACAG
TGCTGACGAACGCGTACGATACGTACTCTGAAGCTCGTCGTAACTGCCCTCGGCCCGTGTCTTCTCAATCATCAAAGGCGAAATGTCGACCTGTGGAAAA
TACCGTACAATGACGTTAGCTGCTTCAATCACTGCGTTGAAACCATCGATCTTTCCTCACCCCGGTGATATGCTTGACGTGCGGACGGAGGAGACGGCCA
CAGAGGCCGGTGCCGCAGCCGACATCCGCCACGACCCACTCCGGCTTTAGCGGCGAGCCTTTGGGGATAAATCCGGGAGGCGAACGCTTTTGCAAGGCTT
CGACAAGCTGCCACGGCACACGGTACTCTAAGTGGGCCACCAGCTTCTCCTCAAAAGTATCCGCAAGCTCGTCGAAAACTTCAGCAACGTAGGCGGGAGC
AGCGGTCTTGGTTGTGGTAGCCCCCTCAAGCGTTGCAAGTGAGTGCACCGCTCGAACGTGACTCTCACGGTTCTCGGCGAGGATTGAATGATACCCAGCT
ACCACGAGATCAGGTTCCTCCAGATAGTACACGGATCTGCAGCGATGAACAAAGGAAGCAAGTCAGACCTTAATGCTACTGTCATCACAACAGCAACAAA
ACATACTAAGTACATACATACCGGAGAACCGTATGCGCAACAGAGTCACTATCGTCAAGAGCCACAACACGCAGCATGCATGACACTGCAAAGTACGTCT
CACCTACACACACAAAGAAAATAGGGCAAGTGAGTTTAGTTCCCCAAAATTCTTGCGAGTCCGTCGTAAGGCTTGGGAAATTGCACGAACCGATCATTTG
CAGGATGGCAGCGAGATTGAAGCTGGACTTTGTGCACGTGGGGCAGCGCAGCAAGACGTTCACAAAGCTCGACGCAGCCGGGAGGAATTGCCCCGTTTCG
AAAAGCTCCAGAGCCTTCTCACGCATCTTCACCAGCTCCAGGTTATCAACTGCCATGGGCGTAGGGATATCTGCGCCTGCGGAGGTAACTTCAACTTGCC
ACAGCGGCTGAAGTGCCTTCCATGCTGCTCCTGGGGACCCGCTGTCTTTCAAAAGCTCACCAAGAACTTCCCCTAGCGACAACACGCAATCAAAAATCGA
CAATTAAACAGACAATATAGAGACAATACCCAAGCCTTACATGATGATCCGCTCGAGGTCGTTGGAGCTGCCTCCTCTTCGTGAAGCTCGCGGAGCTCAG
TCTGTTTATCAAACCACAGCAAGTCAGAACCCATCACACCATTTTAAAGGCCCAATTGCCTAATGCACCACCTCCAGCGCTTTAAGCGAGCCCTGCGTCA
GCGCTTGTCCTTGCGCGTCCAGCAGCACGCACGCCGGTAGGTCCGTGACTTGGAAGTGCTTGCACAGCGACCGGAAGGTTCTGGCAGCGACATCAAACAC
ACGCACACCCACACGCAATTAAACACGACAGTAAATACAATTGCAACTGCGCTGCGGCATCCGTACGATGGCTCGAGTCGCTGCGCTTTGGCGCCTCCGC
CGCTGCTGCTGTCGCCGTCCTCGTCTCCGTCCTCGTGGCGACGAACTTCCAGCAGCCCGATGAGCTGGTGCTGCTGATTGAGCGCGTTGACGCCGCCCAG
CAGTGCGCGCAGCCTCGTTAGCGCCAACGCGTCCACGGGCCGCGTCCAGGCGCTCGAGAAGTAGGCCAGCGTGTACAGCGCGGCGTCGTCGTCGTCGCCC
AGCCAGCTCGCCATCACGTCGGATACCTGCACAGTCCAATTGTGATGCAACATGCGCGCATGAAGTGAGAGTGGTGTGTCCAAATCACCCTCTCTAAGTA
CGACTTACAAGCGTGTTACTGGCTGAAAATGCGAAAATGGCGCCTCTGGATTGGCGGAAAAGACGCGTCGATTCTCCTGGCGCGCGCTCTTTTGAGCCGC
TCGATCTCCAGTCACCAGCAGGAGCTTCGAGCGCCCAGCTTCGCCTACCGCTGCCTGTTCCCCTCTCTGTGTCTCTACGCCCCTACGCCCGTCGCCATGG
GGAGTGCACCGAGCAAGACCGAGCGCTCAGCCAGCAAGCGGTACCCCGTGCTGGCCACCAGCGCGGCTCCCGTACGTGCCG