Description :
From Genome Similarity Track
Location :
Scaffold_584:1607- 2963
Transcript NameFunction/comments
g14601.t1hypothetical protein

Sequence
1356 bases(100 bases per row)
TCATCACCTGCTTGCATAGTTTGGAAGCGAGCTCTCGCACGTGCACCTTGGTTGAATTCATAGAGTAAGGCACCACAGCTCAGTTGTGTCACTGGTAACC
ACTCGGGTTCATCATAGCCTTTCCACTTGATGAGGTACTCTCGGCGCCGCCTGGAAGTACGAGTACGTTTGGACCAACGTAAGTCCAAAATCTTTTCAAC
TTCATACTCGTCCCTTCCAGCATCCGGTTCCCAACTGTCTTCTGGAAGTAGTGCAGCATCAAAGTCGTCATCTTCGTTCACGTTCAACTCCATATTCGGG
CGTTTTGGAAATAAAGCCCGGGGCTTCAAACGACTGATGTGCACCCAAGGGTTGACACGATATCCGGTGTCTTCGATCTTGAGCTTCACCCTGAAGTCAT
CATGCACTTCCTCAATTCGGAAGGGGCCATGCCACATGTGGGCCAACTTTCTGCTCAGTCCAGGTTGGACCTTCGGGATGTACAACCACACCAGGTCACC
CACTTCGAACCCGGACTTCAGTCTGTCGGAAGGTCTTTCCACTTCTGCGTTTGCGCATCCGAACGGTGACGCTTAGCTTTCTTCTGTAGGTCTTCTGCAC
ATGCTTTCGCATAGCTGTAGTCCCGTTGAAGCTTTCGTCGCCACTCATAAGCGGTCCTCTCCTGAAGACTTGATGGCTTCGGACCCAACATTGCAGATAA
CGTCCCTTGGGCGTCCCATCCGTGAACCAGATAAAATGGCGTGTCCAGGCGAGTTGCGTCGAATGACGTATTCAGAGCGAACATGAGTCTTTCTGAATGA
TCGTCCCAATCGCTCTGATCCGCTTCCGAAATGTACGCTCGGATGATCCTGACCACCGTCTGGACGGATCGCTCCTGTTGGCCATTTGCCTGGGGACGAT
ATGCCAGTGTGGCGCGCTGTCGACTTCCTAAAAGTTCTCGGAAGCGGGTGAACACCTCGCTCATAAACCTTGGGTCTTGATCGTGACGTAACATCGAACT
TGCTCCAAACCTTCGGAAGACGCACTCTTCGTAAGCTTCTGCTACGTCCTGAGCTGTCGTCGAACTCATGGGTTTGCACATGACGAATCCGGAAAACGTA
TCTTGGAACAAAAGTAAAAAGGTGTTCCCACGCTCGGACTTCGGCATGTGCGTCACAAAGTCCATCGATACAACTTCGAAAGGTCTTCTGGGTTCGATGT
TTCCAGGCGACGGACCAGCATTCGGAGGTCGTCCCTTGCCGCTGGCACAATCAACACATTCCTTCACATAGCGTTCCACATCCGCATACATACCAGGCCA
ATAAAATTCCGAACGCAATTTCTCGTGCGTCCTGGTGATGCCTTGATGTCCGCCCT