Description :
From Genome Similarity Track
Location :
Scaffold_66:160688- 162763
Transcript NameFunction/comments
Physo_157884hypothetical protein

Sequence
2075 bases(100 bases per row)
CCTTCAGCGGACGTCTACGCGATTGCGGCGTGGACGCAAAGCTGTGCAGATCTTCTTCTAATGCAAGCAGGAGCTGATCTTCTACCTGTACCTCACGCAA
GAAGCAGCGAACCTTTCAGGTTAATTAACACGCATACAGTAGCCTGGTGATGGCGTGGCGTTCCGCAGCTTGTGCAACCGTATCCATAGGTTTGGCACAT
CTCGGTTGTTCATCCTAAGACAAGTTTCGCCGGTCCCCATATGCTGCTTGCCCGCACCTGCAGCCCCACGTCACAAGTTGTGTGGGCAACAATCACAACC
CAATTGGAGCCCAAGAGGAGCGAGCAGACCATGGCGGGTGCAGGAACTCAAAGAACTCAAGCTCCAAGCTTGGCGAGAGACATTCAGCTGGACGTTGTCG
AGCTTTCGGATCACCCTGGTACTCCGTCAGCCACGCCTCGGGAAGACGACCAGATCCTCGTCAAGCAAGCCACTGACGCCTCGGTCGATAAGGCCAAGCC
TGCTCCAGCTCCTCAAACCAAGGTTCTGTTCCTCGATGGCGCGCGTGGTCTCGCCGCCATGCTGGTCGTGGTGCAACACTCGCAAGAGTTCGTGCCGAAC
CTTCACCTCGGATCGGTTGGCGTCGACGTCTTCTTCGTCCTGTCGTCCTTCCTGCTCACGTGGCTCTTCATGAAGAAGAGCAAGAAGCTGCTGGCCCAAG
GCGCAAACCTCCGCACGTGGGCGTTCGTGCTGGCCGACTACTTCCAGAAGCGCTTCTTCCGCGTGTACCCGCTGTTCTTCGTGACGGTGATCGTGCTCTC
CCTCATGTCGAAGGAAGACCAGAAGCACTACTTCATCGGCGGCCGACCCGATTTCGACATGTACAAGACACTCACGTTCAGCTACGAGTACCGGTACCAT
GTCTTCTGGACGCTGCCGCTCGAGATCTCGTACTACTTCGTGATCCCGGTATTTGTCTTGGGCGTGCTGGGACTGCGTCGCTTCTGGTTGGTACCCGCCG
TTCCGTTGATGGCGTGGATCGTGTACGAAGGCATGACTGTGTACCGACAGAGCCACATGCCCATGCGACCGCATATCGGGACGTTCCTCACGGGCTCCCT
TGCCGCCGTGGTTTTCGTGAAATTGGATTTGTGGATCAAGGAGACCAAGTTCACCTTCCGCCTGTGGCACACGGTGCTACTCCGAGCAGTCGAGTGGCTG
TCGATCAGCATGCTGTTGAGCGTGATCTTCCACGGCCTGCTCTTCACCTGGGTGCATCCGAACCCTGCGCTGCCGCCCGACGGCTTCCCGTACACGAGCG
CGTTCCTGGCGATCATCTTCGTGATCGAGATGATCCGTCCGTCGTGGCTGTCGACGTCGCTGGAGTGGAACGTGCTGCGCTTCTGGGGCAAGATCAGCTT
CTCCGTCTACCTCATGCACACTTTCATCATCGAGAACCCGAAAATCTCGGCCCAGGGCAACTACTTCGACCGGTTCTTCTCTAGGTTGATCCTCGTCGTG
GGGCTCTCGACAGCGACCTACTACCTGATCGAGTACCCGTCGCAGTTGCTGGCTCAGCGAGTCTCGCGCATTCTGGCGGAGAAGGAGAAGCAAGGACCTG
ACGGAGCTCACAAGTTCTCAAGTGTCAACCGTAGTCAACAGTAGAATGTATATGACATAAACTCTTGTTGAAGTGATGTTCTACCTATCGAATGTCATAT
TCCGCCGTCACATCGCCTTGGCGTTTGCTGCCTTTCCGCTTTAACTGTTGTTTGCGATCATCCTCCTACTTCATACCGTAAATTTCAGTGAGACTAATTG
ATTTTTACGGTAAGTAATTAGTCGTAGGTTGAACCTGGTAATCAGACTCCCTCGAACCAGGGCCATGGAAGGCGAGCGCCTGCCGCTGCTGCCGCGCGCG
TCGACCGTGGAGGAGGCGCGGCTGCGCAACCTGGGCAAGCGCGTGAAGCTGCACTCCAAGCGTCTGCGGCAGGTCTGGCCGCGCATCGCCGGCTTCCTGG
CGCTGCGGGACGTCGTGTCGCTGGGCTCCTCCTGCCGCCGACTGCAGCGGCTGCTGGACAATGATCGAGTGTGGT