Description :
From Genome Similarity Track
Location :
Scaffold_135:16068- 18701
Transcript NameFunction/comments
Phyci_84975Hypothetical protein

Sequence
2633 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCCCTCCCGCGCA
CTTCAGTCAGGAACCTCCATTCttcgacttccagcctcatacgatcgtatcatgaagtgcgcgaagatcaattgtcactggagtgccatatcggagactg
ctccgtgctgtgtatgtggccgtcaggtgcatcacctgtgtagtaacgagctatgcactaaagacgagctctctcaaaggtaacgttgctgtttggcgtt
ggttttttgccgcggtgattgtactgagcaagtccacgtacagattctgcagccgcgcgtgtggtctgacggtcttcaacgcggatgacagcgacctcca
ggagtccactccgagcggtacctctggaatatcgtgctcaagtagtgccaccgtaatcgatctgagggaaacagagctcgaggggggcccggctgtagta
aatagcgttccggatcgcatcactcacacacccctgcgaactcgacagacccgatttggactttggttcaccagcttggaaagccagtcgcgtacaagaa
gaagcagtacacgcatatttgcatggtatgtttggagaccaaacctggcaaaacgcactttgtcgcgctagccacgcctcaaacgccaagacgcattggg
tatctgcccacaagacgcatgatatggcaattctggagcttcagcgtcgccaagttcgagctgaccgcttcatggtgaccacgccgacggagacaaaacg
cccagctgaagacgagctatctaccaagcgccaaaagacttggtggaaggcgcctggtcagccaagaacaaatcactggtcacatcgcgcggtggctgat
tcgggaaggcgagtgttccggtttacttttacggacaatgttttactgttgttctcatttgtattatttaaaggattggtccacaacctcgtgacaacag
atgcctttcatgactttcttgtaggtgTTACTGGGGATCTTAACGTCACCATTCCATCCCGTAAGACATACAACGACATTATGGAATCACTATGACACTT
TCTCGAAGGATACATCGGATTTATTCGCCGAAGAGTTCCAAGAGTTGGACGAGACTCCGTTTATGACTGTGGAGCACGACCTGTGGACCAACAATTCGAA
AAACAGTATTGTGGATGTATCGGGTAGCTACATTAATCGGCATTGGCGTCCTGTGCGTCTCGCCCTGCTCGCAGAAGTAAAAAAAATGATGGCCATGATT
CCGAGGGTGTTGCAGAGGGGATGGACGAGCAGCTCAAGGCTCGGTACGGCATGGACACTAAAAAAATGGTTCGCTTCACAATCTTAGATACAGCACCAGC
AGCTCGAAAGGTTACTAGACAATTTAATACAACTTTGGAAACGTATTGCGCGATGCACACTCTCAATCTCTGTATTGGTTATGGAATCGGCCTCAAAGAG
AATGCGCGCAATGAATACGTGAAGGATCCGAAGACAAACGTGTTCGTGAAGAAGCGCGTTGTAGTGACGGAAGGCGGTGCATTTCCCGAGGGCGGTACAC
TCATTCGAAAGCTTCGTGCTCTCAACAATTTCTTCGCGTCGAGTAAATCACCTGAGCGTGTTGCCCGCCTCAAAGAAGTCCAAAATTTCCACAAACTACC
GCAGTTGGCGGCGCTAATTGATATTGACGGCCGAGTGGCATCTACAGTCAAATTATTTCAACGTTCGATCATTAATTACCCAGCAAGTTCGCATTCTGAA
GAATGCGAACTTGCCTAAGAAGGACAAACGCGTTTTCAACTGTATTACGGGCGCTGAGTGGGAACTTGCAGTACAGATGGAGGCAACCATGCAGAGAGTC
TCTGAACTAGCTCTTGCCGAGTCCCAGTCGGCAACCATGTTATCGTCTACTGTGTACGTGTTACTCCGAGTGGCAtcggctcgaatgaattcgtacaagt
ttgcaacctactgcctgcatggacctcgcgatACCGACACTAACGAGAGGAACTTCTCTCGAGTTGAACTGAAGCTGACTGATCTCTCGGACTTGGCGCA
CCGGTGCATTAAACGCACTCTGCATCAAATTGCAGAGAGGTTTCCCAAACCATCAGTACCCGTAGGTATGGCGCTACCGCTTGACCCACGAACGAAATCG
TCAGCCAAAACTTTTCTACGATTTCCGGACACGGCGGAGGCTGTGATTGACACTATTTTGGAGGAAACAAAGAGTCGGATGCGCATTGAACACCGTGTTT
TTTACTAGGGATTACATGCAAACGACGGACAAG