Description :
From Genome Similarity Track
Location :
Scaffold_79:160670- 164008
Transcript NameFunction/comments
Phyca_LT153451775PREDICTED: uncharacterized protein LOC101514300 isoform X3

Sequence
3338 bases(100 bases per row)
attgtgtgcgcgttgtgagccgctaatgtccacaggtattggacgaaggctctcgtaaatctgtcgaaggtctacccggaacagcgcgtctagacggcag
cgattgaatatagggcatgcccgccatcggctaatacattgacttaagtactggtgcgtgcccttgatgttgtcgtttaagtacgatatttatttgcgtg
cttgaaccttttgcccaggaacgcagtggaaacctggatttgcaggggcgagagcgtttgatggataaaagtagaaaggtccaagtagcagtttcgctgc
acttcggctcgactagtaagttaacattggatcatcataatgttccacatcttcaacggtaacactttttgtctctgcagtccaggcccaaagtttggaa
cgcagaaaaatttggtatgtatcaaatgttaagttgatccgcaacatgccgatgctgctttggctacatagtagaacgattccaatctgccttgcgcttg
aacaatgacgtcgccgaaaattgctgcccacgtgtcttcatctttcgtatctgggagatacaccgtcaaaaccgttgttaactaaattattgacgtacac
aacatctccaggtcaatgtacaaccacaccagacgccgttttctccagcattccattgaatgagtcattcttgtttctcctcttaaaagtcgtggtggtg
ctcttagaaaaatagacccaaatcttgaaacaccggtttgtgcatggtggtatatacgacaccacccttccgtggtccatatgaattggtgtttcgcagt
tcccaatttgccgccaatactctgatggaaaactgaaaggtttggcgttcttgaattgcagcttgctaagggagtatacgagctcgttgctagcgtaagg
tcgatttgcttcccactcgcaatcaaggcacatcgcacggttatttattgggtttgcaagaagtaggacttcgttgggcttgtgcgattttgagtagggt
taggtaattttgtgtacatcatgcccttatacatgtcctttcagaagggccgcggtagggtaagggttatggctcttttttaatgcaatttgggtacatt
tcgcaggggacgcatccggagcctgggcaaggttgaacaaatctgcgcttcactatagaatctaccgcgaagctatctgctctactggtgctcctgtgtg
ctgtcgctatcgctgcgagcagaccgtgtgttaagtgtcccgtttgggtttctgaatgccaaatatataaggctggcgccatatttaagctgctaagagc
acacatttaattggacatacaagattggaaactgtatcgattggaaatgacaggaaattcgttgggtgagctgataaaacaactgcgaatactagttttg
tcaggtgattataaacacagaaaaaaaacaactgcctcgcatctacaagaaacatttcgaaagtaaggaccgatatgtccttagtgcattcaagtggagt
gtttctgttgcgacagatactcctgtattagttttttttcttaacgcatgtgacgttgttgcaggatttcgcgggcgcgcatccttactggcaggcatgg
atcatctattggtcggccttgatgccgataacgtactggactacaatacggagggggtgcatgcgtatatacattacataaaagtacatcatcgatttac
ttacaacttatttgtcagcaccatacgagtggatatgaatcagagaactgtaagaaaccctagtacaagaaggggtgacagttgggtataataagggacg
acaatacccgagactctcctccgaaggaaagagaccttcacatcatcttttgctactaaaaccaacacatgaccaaggcgctgctatcggtgcagcccag
tttgtggatcaaagacttgaaagccgggtacgtagcgactacagcagtattcgcggcgttctgcacaagcgaaagctacccggatctactgaaggggaga
tttgtggagctgcccggtgtggttgccacgcacatcgacttactcgtcacatccaattcaagtcaatggcccgctgaaaagcttcgcgccgcacctttct
tgtctacattaaaataccacgatctccatagacactcgtgttggtacagttttgcgcattcatcgctcactcttaactcgagccttgattttaacttccg
ggccaacgaagttgtggtagtcgttaacccattgatgggaataacccatcccagtcaaattcgggttattctccagtgtgtgcagcgtattgaatctcag
tcacataagatttaaacatatcagatataatcagtgtgctgttacaaaaaaacataaaaatgttttaaatttggtaaagaaaactataagaataatttta
aaaaagcatgcccgggcttgatgtacacagcgacaatgtgggttttgcatgcgcacactgttctcgannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntgcgtaccatgggttggtcacagcggtggcagt
gtgctgacggagcaaggaggctgacgcgcatacaccacaccatagccccttcttccgtcgagcgcgctgtcgaatgttaannnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngtacgttgtcatcttctcga
actggtatacgtatctccccaccaaaatcacaacctcaaccagtagagccaagagaaacacactggaaccgccagttaaagcccggacttcggctatact
tcgtgtccttccagacggtaccttcgttgagtggccaagtgatgttgtgcgccttaaaacgcatccctcgaattcacagattcaattccacgtctacaca
tctgacacttattgcatgggcccagaatcgtgagctctgggtaactgctaaaatctgaaggaaggtgtggtttgtactccaaaaaattgtagtcaaacct
ccaccagctgcggacggcgtatgaatgaagctcgaggtgtaaaaataagcgtgaaggagtcacagggtttgtgtttgcttgcatcacgtcgaattcgaga
gaattgggtggtctgtccttacattgcgaagatgtgtttgaagaatccacactgttaagctgaagacgaaggattcaaagaatcgagacgtgtacattgc
atctgacgctgtcgggaatatggggcgatttatcaatc