Description :
From Genome Similarity Track
Location :
Scaffold_64:160667- 165527
Transcript NameFunction/comments
Phyci_313896Hypothetical protein
Phyci_230422conserved hypothetical protein
Phyci_94178conserved hypothetical protein
Phyci_230401conserved hypothetical protein

Sequence
4860 bases(100 bases per row)
CTCCGCCGCGATTGGCCAAAATATTTTTAAGGTCCACCGGCTCGTCTGCTCGACGCGGTCTGGAATTCCGCAACACAAGGAATGCGCACGGTATCGAAGC
TCGACAGGCGTTTTCCGGCATACAAAGGCGGTCGGTCAACCAATCAACCGAACGCCGACTTCAGAAAGGAAGAAGGCCGGGACGAGGAAGAGTGCTCACG
TCGCAGACGCAGCGCTCTCGCGGACCCCACAGCCAGCGCCAGACAGCAGCACCCACAGCGCCAGACGCACAGCTCTCCCAGCTACTCGGCGACCCCCTCG
CGCCCTCGAACAGACCAGCAGAAGCGCAGATAGACAGGGTTGAATTGAACCAACGGGCCATGGCCAAGCGCATCCGAGTGACCAAGCAGGACGCGGCCGC
ACCGGCGCCCACAGGCCTCGCAGACGCAGCCAAGACGAACGCACCCAAGGCCAAGGCGGCCACGCCCACCAACGCGGAGGGGAAGCACGTGATGCTGCCC
GCGTTCCTGTCCAAGACGTACGAGATCTTCAGCATGCCCGAGTTCTCGCACGTGTGCGGCTGGAACGCCAACGGAGATACCATCATCGTGTCGCAGCTCG
AGGCCTTCGTGGCGCTGgtgctgccgcgcttcttcaagcaccgcaacttcccgtcgttcgtgcgccagctgaacctctacggcttccacaagACGGTGCT
GGACTCGAAGCGCCTGGAGTTCCAGCACCCCTTCTTCAAGCGCGGCCGGCCCGACCTGCTGCACAACATCAAGCGCAAGGTGTCCAGCAGCAGCCACCAC
AACCAGCAGCTCGTCAGCTCGTCGCTCCAGGTGGGTTACGACCGACGATGGGACTGGAGAGGTGGGACGACGGACTTACTCTATTTTTTTTTACTTTTTT
TTTGTGTTACAGAACTCGCGACTTGATGCGCATCGGGAGATCTCCGACACGCTGCTGCGCGAGATGAAGGAGCTTCGACAGCGGAGTGATGCCATGGAGA
AGCGACTGCGCGAATTGGAGATAGACAATGCGGTACGGGTGATGGGCTACTGTGCATTTTATTTTGCCATTTTTTTATTGGAGAAGACTTATTGTATTTT
ATTTTGGATTTATGTAGATTGTGCGCAGTGACAACCTCAAGTTGTGGAAGCACCTCGAGTCGGCGAAGGATAAACAGCTGATCATGCAGGAGAAGATGAA
GAAGATCATGTGGATTCTGTTCCAGATCTACCGGGGAAAGCAGCAGAACCTCCCCAAAATCTCCAGCAACGATGCTACGGGCGCCGTGATCAGCGAAGAG
TAAGTGTCGTAAACTTGCTGACCTGGCTGGCGTGTTTTTGCAAGGCGGAGTATGTGATTTGTGACTAACCAGTTTTGCTGCTGTGTGGTGTTTGCAATTC
GTGCCTGCTTCTCGTTGGCTTCGAACTTTTCTTTGACCTATTGGTAGCTGCTACATCAACAGTAGTATGCTTGGTCCGAAGGAATTCCGAGACGTACTGC
GATTTTTGGCGATGGACGAGCCCGCGTTGCTGCCTGGAGCCGCTACCAATGTAGCAGCTGCAACAACGGGATCTCGAAAGCGAAAGTTTGTTGAAGTTCC
GTCCGATATCAGCACTGAAAGTGCTCCATACAAACTAGGTGCGCTACCTGTCTTGCATTGCAGCCGATGGATTTTGTGATTATACTGACTTATCGTGTTT
TCCTAGATGTAGAGCCGTCGTCTGTTGTTGAAGTGCCCAGTGCAGTCGAGGACCCCAACCCGTTTGCTATGACTGTGCCATCAAACCCGCTTCCTGTCAT
GCATCAGGACGCTGTTCAGAACAATATTCTGAGCATCTTCTCACCGATCAAGAACAGCAGTGTGCCCAGTGTGGACTCGACGCTCAGCGGATTCCTTACA
AATGGCGTGGATACTCTATCGGTACCTTCTGTATCTGCACCGAAGGTATTGACCCCAACAGTATCAACGCCGACCCCACCTACTCCCACCGTGTCGACGC
CGACAGTAACCACGCCGGCTGAAAGCCAACCACCAATGGAAGCTGCCGCCGCAACGCCGAACGGTGCCACGACTGAGTCAACTGGTGACGCTAATAGCAA
CAATCAGCTGGCATTTTTGGACGAAGAACTTCCTTTGCTGCCCGACTCGGACCACTACAACTTCACTGATGGCGAGCAGGTACTGTAACGCATCCTGCGG
TCTTGGTTATCTGTTTGTTGGTTGCTTTGTGATCAGTGGTGTAATGAAGTGTCTTTGTTGCTGGACTGTGCATTAGCAGGCAGTAATGAAGAAACTCGAG
GATTTTGAGACGTCTCTACTGGACGAGTACGATGTCAGCTGCCTCGATACACTGCTGCAGCAACTGAAAAACTCGAATGGAGACAAACCAGCAGGCGTTT
CAGTGGCAGACCCGGAGGAGGTCGTCGTTGGACCAACCAACGCGTTACCACACGACGCGTAATACGGCAAACCTACAGACCAATACCAGCTACTATCGTG
GCTGTGGTCTTGCTCGGGAAGCTGGTGAAACCTGTGAAGACTACCTTATCGAAGAACTTACATATCCACGTACATGTCAAGCGAGTTGCCGCGCGCGCGT
GTCGTCACTGGTGAGAAGAGCTGCGCAGCGTTGCAATTGCATGCCTGGCGCTCATTTTGTCAGCTGATAGACAAGCTACAGAGCGCGTTGACCCGCGTCT
CCTCGTCCGGATAGAAACAGGTCGAGTGTGGGAAGTCAACAAGAAGAATATCAAGCGGAGCGGTGGGCGCGAGAGAGGAGCTACCTGATCGCGACGCGAA
ACTAAGAGACGGAGACGAGTTCGTACGAACAAACAGCCAACAGTTGATGCGATGGGCATTCGACGGCAGCGAACGAGCGCTCCGAGACGATGACGAACAC
ATACACGCGGCTGTTTTTATTTATGCAAAGATTGCGAGAATCGAGACAACCAAAACGAGAAAACAAGAAAAATGGTTTAGTGTAAATACTCTTCCTGTCT
GGCTGCTGCATGACCAGTGCTCTTTATCCTCTAGGTGCTGTCTGTTGGCGGGTCTGCGTCTCCAATTGACTACGCAGTCGTTGGATCTCCTTGTCCTTGC
GACTGAGCTCCAGTTGGGCCGTGGCGAAGAGCGTGGAGATGTTGGTCTCGAGCTGTTTGTTGGCTGCTCCAAGCTGTCGGTTCTGCTCCTGCAGCAGCGC
CAGTTCGTCCTGCAGCCGCGTGTTCTCCTTCTCCACTTGAGTCTTGAGGTCCAGCGCCTCCTTCTTCTCCAAGGCACTGGTGGACGTGTCCAGGTCGCCG
TATAGGTCTTCCTCGGTATTGCTCATGGTAACCGATTCACAAGTGTGCCATACAAACTCCAAGTCATAACGCATTCGGAATTAGACGGAATTCCAGTAAC
AGTGTGTTCGTCTCTACTCAACTGTACCAGTAGCGAGACATCATGGACTCGAGGTGCACCAAGTTCTGGGAAGACGGCCAGGCGCTGGTGGCGACCATCT
CCGGCCCGGACAGCGCTGCGAAGATGGACACGACGCAGGGCAAGATCTTCAAGGAGCTGCGCACCATGAGTCGCTTCTTACAGCGCAACCAGAGCCAGCG
CTTCAGTGACGCGGCGCAGCAGAAGCTCGTGGACTGTGTGGGGCACTACGTGGGGCTCGGCAAGCAGGGAGGAGCCATGCTGCCGGTGGCGGAGGCCACG
TTCCAGACGGTGAAGGACGGCCTCGCAATGCCCTTCAACGTGGTGGGCACCAAGCAGAAGAAGCGCCTGCTCAAGTGGTACAACGAGCTCATCGCAATCG
TCGGCGGCGACCCGGACGCGGCCATCGCTGGCGAGGTGGTGGTCGTCCCCAGCATCGAGTGGAGCGTCATGGACATCGACGAGGACGGCTTCCTGTCACT
CATGCAGGTAGAAACGGGAGATACAAATGAGAGCTTCCAGGTCAAGAAGAAGAGCGCAGAGTACAAAAAGATCAAGAAGGCACTGGAGGACCGGGAAGTC
ATCGTCGTCACCAGTGGCGACGACATCGAGGAAATCCGCGTCCAAGACGAGTAAATGGGGAAAGCTTCCTGCCTGCATGTTAGAGCATAATTAAGGGTAG
CCCGAACGCATCGAAAGTTCCAAATGGCTGCGTCATTAGAACGGACTGGCAGCACCCGACTTGTCACGACTCTCACTCCACGCCTTGGCGATCGTGCGCT
TCATCTCGTCGTCACCTTCGTCGTACATGTTCTGCCAGGAACAATACACCAAGTCAGAAGATATCACAGCCTGCCACAATTGTATACAGAGCCCAGCACG
CACCTTCATCATGTCCATGATGCCCGCCGACGGGTCGCTCGTGTCAGGCTTGCTGGTCTTGAGCGGGTTCTTGGCAGTAAGGTTCATCCACGTGTTGTCC
TTGTCCGCCTTGTGCAGCGAGATCGTGACGCGGTTCTTCTTCACGCGGAACGAGCTCTTGGCCGGGTCAATCTCCTTCTCCAAGTGCTGTTTAATCAGAC
TACAACAACAGCAACATCAGCACGCAATCATCAGTTCTTCTTTCCACCTACCCCTGCCTCTTCAGCCAGCAACGCACCGGTAGTTCTTGCTCTCCAGCCC
AATAATCTGTCACCACCACCACCACAACAGCAAATAATCATTAATGCAATCTACTACAGCTGTCCAGATCCTCGCCTGCCATTGCCAACACACCTTGAGG
TCGAACGACGTCTTGGTGAAGTGGCACGTGACGTTCTCCTTGGGTAGATTGCCCACGCCGTCGACGCCCGACATGATGTAGACCGCCACCTTGGGCTTGC
CGTAGCCGTCGTCCTCCCACCCGAAGCGGCTGATCTCCGAGAACGTCGCCACGTTGCTGG