Description :
From Genome Similarity Track
Location :
Scaffold_156:16065- 18025
Transcript NameFunction/comments
Pytap_DAOMBR444fgenesh_masked-pag1_scaffold_156-abinit-gene-0.46Bos taurus similar to Leucine rich repeat containing 45 (LOC514524), mRNA.
Pytap_DAOMBR444maker-pag1_scaffold_156-snap-gene-0.10Kinesin putative,

Sequence
1960 bases(100 bases per row)
CTGGACTTTAGCAACTCGTACTGGGGCGATGACAAGGTCTCGGACGTCGTAGAGGCCGTGCGCCGCGCCGCGTACCCCGTGCAACTTGATCTACGCGgCA
ATCGGTTCGAAGCCAGTGGAGCCAAGGCGCTGGCTGAGATGCTCAAAGTGCACCGCAGTGTCGTAGCGCTGTGTCTGGAGTGGAACAATGTTGGGCTTTT
GGATGAAGGCGTGGAGGCATTGGCCGCTGCTCTCGAGGTCGATTCAAGACTGCTGGAGTTGGATCTGCGGAACAATAAtATTGGACCTGAAGGAGCCAAA
GCTCTGGCAAAAGCGCTCAAGAGGAACCGGACGCTACGGAAATTGGACATGAGGTGGAATGAGATTGGAAATGCCGGCGTTCTGGCATTTCTAGATGCTC
TACAAAGCAATCACGTCCTCATCTCGCTCGAGATCACCGGGAACAATAGCAGCTTCAAGCACtCTGAAGAGATCGAACGCTTGCTGGTGCGGAACCGAAG
TATCCAGGGTCAACAGCCGCCTGTGGAAaTGGAAAAACGCGACGCAGAAGCGGCAACGTCGCCGCaCAAGCCACAATCTAACCACAGCGACCAACTTCTG
CTTCAAGTTCTCGGGGAGAAAGAGGCTCTCGAAACCGATTTGAACATTGCAAAGCGCCACAACGCAAAGATGGTATGATCAGTtGGTCGGAATTAAAaCa
gATCTTCTATAACGTCGGTGGCACATAGGTTGAGAAGGTGGAGGAGTGTGAGCTGCAGATCCAGTTNNNNNNNNNNNNNNNNNNNNCAAAGGCTGAAGCA
CACGATgCTCGCATGCGgTtGGAaGAACTTGAAAaCcGACGCcGTGTCGAGTTtGAAGAGTATCGGGTTtCTCGTACGTCTCTGgAaCGaGAaTGTAATG
TtAtGAGAGAGAaGATGgATCATTtGGAGGCACTGCATCAACAAGGaGACGATCAAAAGAaCAAACTGATTGCACAATTGGAGGAGCTCAAGTATAAGTT
GGAGAGTGAGGTGCATCGATTGACCCTATCAGCGGGgTGGGTACTAGATTGCCAGCGGAGAATcaTTTGAGTACTGAAGCTTGACGTTTCCGTAGATCGC
AACAAGAAGAGTACGCTAAGCTCAAAAAGGAGCTACATGACGTGTCTAAGGATTACGAACGACGAGAACAAGCCACGCAGGCGAGCTACAAGGCAGAAaT
GGCGAATATAGTCCGCCAACACGAGCTTACTGTGACTGcgTTACAATCTCAACTGGCGTATACCAACGAGCAACTGAACGATACGAAGCAGTtgaTGGCG
GATTTGAAAGAcAAGCATGATGCGATACAAGCTATGTTGCTGCAGGAGCGAGTTTCGCATGAGAAGCAACTTCACGAGCTGAAGAAACAATGGGAAAGCG
AATCTCAGGATCGAATGCACCGAGCCATGTCAGCAGTTGAGGCTCAGGTCGAAGAGATCAAGAAGAGCCGCGTGTTCTTaGAGAGAGAGGTGGAAAAGCA
TTTGGATACGATTGTGAGGCTTCGGCAGGAGAACGTCGCTCTACAACAAGCAAGTGACgaGCGACTACTGAATATCCAGAGTGAAATGGACCGCCAGTAC
AAGGAACTGCAAGAGAAACAGGATCAGTTACACGATgaCCCAAAAGGAGACTGCGAAAGTCAATGAGGCGCTGCTGCAGCTCCATCGGAGACTTGAGGAC
CAGGAGCGCTCGACCACCCGcATGAAACAGGTGTACGATGATCGCCTACGAACTCAGTCTTCAGCAACAGAGGAAATGTCGACGCACTACAAGAAAGCCC
TAGTAGAAAAGGAaGAAGCGGTCGCTCGCCTCGAAAACGACCTGCGTCGACTCGATCGACTGCTCTCGACGCAGCAGCACgAGCATGAGCAGCGTTTCGA
CGGCTTGGCAGATGCCATGGCGTCGTTTCTGCAGAGCCAAGTGAAGAAAGAGCATGAACG