Description :
From Genome Similarity Track
Location :
Scaffold_170:16061- 17263
Transcript NameFunction/comments
Phymu_g5978conserved hypothetical protein

Sequence
1202 bases(100 bases per row)
GGGCCCGAGAGACACAATGGCTCGCAGTCGCGGCGCGTTCATGCGCATGTCGCAAACTTTCAGCCGCGCCTCGGAGAGGATTGACAATCACTCTCATGCT
GAAGGACGGCATCGCCGCGCAGCAAGACAAAGCGCCAAGTATGACGTTGCCTGGCGACAAGACGACGAGAGTGAATGTTGCCAAGTCTGTTTTGCCATGT
TCACCAAACTCTCCCGCCGACGTCACCATTGCCGCGTGTGTGGCGAACTCGTGTGCGGCGCCTGTTCGCAAGATCAAGTTTCCCTAACCGACAAGTTTTC
CACCCCACGCCGCGCCTGTGTTGCCTGTTGCAGTCTGCTGCAAGCCATGGCACGAGCAGGCGACGAACGAGTGAAAATTGTCGAGCCGGAAGTggcaact
gcaactgcaactccGACGAAACGACACCACCAGTCCGCGCCTgtggcttcaacttgccactCACCCGTCAGTGCATCGATGCCTGCCCCAGCGGCAACCC
CTCGCTACCGTGACCGGCTGACGGAAGTGCACCGAGTTATGGCTGCCGGCAAATTATCACGTCGTCGCGGCAGCTCGGAGAAGAAAATGTACGTGATTTC
CAGTCGCTGGCTGCGCGATTGGCTGGCGTTCACGTCGTCAGCTTCGAACTCGAGATCCAGTCGCAATCTCGACTACGACTACGGCTTCGACTCGGAGAAG
TCCATTTCATCTCCTACCAACGATGACGTTGCCAGCTCGGGCCGTGCCCCTGGCCCTATTAACAatttgccactgctggagctttcgcGTGGCAAATTGG
TGCGTCGCCCAGGTCTCATTCGAGATGAAGTCATTGCCGGTGACGCGACAAGTGCcggtgaagacgcagatTTCCAGTTGTTATCACCTGAAGTCTGGGA
GGTTTTCCAACGTCTTTACGGCGGATCCCCTGCCATTTACGTCAACTTAACCAGCGCCGACCCCACGGCGTGGAACATTGACATTTCCGGTTTGTTGGCA
ACCGGCACGAATGCCAATGGCACAAAAGTGCAAATGCTTCCGGCAGTGGAACGCGCATTGACAACGCGTCACCACAGTGAAAATAGTTTTGCCAATCCAC
AAATTGGTGCTAACCACGCCAGAACCCCCACGGAATCAGGTTCCTACACGCCAGTGAGTGGTCGATACACGGTGTCAAGCTCGAAGCAACAGCCACCGAA
GA