Description :
From Genome Similarity Track
Location :
Scaffold_51:1606- 9106
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_51-snap-gene-0.46Radial spoke head 10 family protein
Pytve_DAOMBR484maker-pve_contig_51-fgenesh-gene-0.1Protein TAPT1 homolog
Pytve_DAOMBR484maker-pve_contig_51-snap-gene-0.47RNA-binding protein (AFU_orthologue; AFUA_1G02510)

Sequence
7500 bases(100 bases per row)
CATAAACAACGACTGCAATGGCGTCCAAGTACTCTGAGAATACGAGCCGCGAGTCGGGGAAGAACGGATCCGGACGGTCGTTTCCATCACAATCATCTGT
CTGGATTGTGTTGGAGCATTCAGGCAGCGACTCCGCGAATGCCCAATCAAGAGCTTGGAGCGCATCGCGGATGCGAAACGAATCTGTAAAGACCGGGTCT
TGCGGAGGCGACACGCGCCGCAACATTGCCAACACTGACCGGAGCGAGACTGAGGGTGGTTTACTCGAATGGACAGTCGCGGCTTGGTTGGTCGCGTCCA
CATCTTCATCCTCACGCGGCTCACAGCAGTCGTCAAACAAGCCTAAGAGCGTGGCGCGGTGCTTGGCGAAGATGATCTGCATGGGCTTGGCAAGCAACTG
GGTTCGCATCTGCGCCAACCACGTGACGGGTTCCCGCTGGGATTTCTGTCGCTCGAGGGTCATTTGGCCAAAGAGATCGGTAACCGCGTCAGCCAGGACG
GTCGCTCCACTCTGCGCAACCAAGTACTGTGCAGTAGGGTCACAGTTGGTCAGCCGCCAGAACGCAAGGCGCACGAGGAGCTCGACAAACTCGCGGAACA
GCAGCTGCTGATCGCACGTAACGACTTGTAGCTCGACCGGGTCAGCCGGATGTCGCACGCGGTATAGCAGTGGGAGGTCCTCGGCCAGTGTGTCCACTGA
TAGAGGAGTACCATCTTCACTGGTAGCGACAGCGTCGGCAAGTGCGGTCTCGCGCTGAGCTCGTCGAATCTGATCCACAATATCTTCGAGCTGGCTGCTG
GGTAGGAACAGACCACAGGTCGATAGGAGCTGACGGCACTCGAAGATCTCCATGACTGAGGCGCAATCATCTGAGTCGCCACTACCGCCACTTGCGCGAC
GAACTTCTTTGATCCAGTGGCGATAGAGCGACCGCAGCTCAGAGTTGATGCGCAGCGCCGCATGTTCAACGGCTTTGCGTGCCTTGGCAGCGAATGCGTT
GTCGTTGGGGTCGAACAGATCTCTGATGCAGAGTATAATGCCAGTGTTACTCGAAGTTCCCGGCGAGTGTGTTGTGTTGGTCGGGGACGCTGGCGCCTTT
AGTCCAACTGGACGATCCTGGCAGAACCGTCCAACGAAGACACGGCCGTCTTCATAGAAGAAGATCCCCAGTCCGTCCTTTACATTAACGAGCCACTCAC
CCTCGTAGCGTGCGCCATTCGCATAATAAAAGACGCCACGCCCGCTCCGCATCCCGTCGCGGAACTCGCCTTCGTACCAGTTCTTCTCCCGAGCGAGTCC
GTTCCCACTCGTCGTGAGCCACACGTGGCGACCAAAGCCGTGCTGTCTGTCGCTGACCCATATCCCGTCGTATCTCTCGATCGCCGTCACACCTGCGCTT
TCGGTCCACGTCATTACGCCTTGCCCGCACTTGACATCGTCTCTCCACTCGCCGACGTAGGTGCTCCCGCCGGCGTAATGCATGGTACCTTTGCCGTGGC
GCTGACCCTTGACAAATTGTCCCTCATACCTCACGTCGCGCTCCTGGTCGAACACGAGGACGCCATCGCCGTGCGGCAACCCGTCAAGCCACTCGCCTTC
GTACCGCGCACCGCTCTTGACGTCCACGCTGGCTTCTGGGTCATTCAGTTCATAGCTGAACAACATCGGCACCGCCGGATCGTCAGGACCTTCGAGCTCA
TCAATGGGAATATTGTCATCATTGTGGAGGCGTAAGGACCCGCGCGTGCCTGTGCAAAACACCCCGCGGCCGTGACGTCTCCCGGCGCACACTTCACCAA
CGTATGAGCTCCCATTCGGCCAGCGGAAGGTGCCGACGCCGGAGATCTCGTTCTGTTGGAACTCGCCCTCGTACTCGACCCCAGAGGCGAGCCATGTCAT
CTTCCCTTGGCCGTGCATGCGGCCGCGCATGAAGCCCCCGGTGTACGTGAAGCCCGCGCGGAAGACGAGCGTTCCCTGGCCGTGGTAGACCGGCACGTCG
CATGCGGCGAAGCGACACGTCTCGCCCTCGAAGCTCTCGACCACGTGCGCGAGCACGCGCGGATCCAGCGGCGGCCGTTCCTGGTCACTGGCTTGATGCT
TGGCAACCGGATCATGAATCGGGTCAGGAACCGCCTCGTGGTCGAGCGGATGGACAGCGACAGCGACATCTCCATCGCTCATTGCGCCGCTTGATTCTGC
TGTTGCAGTGCTGATTTTTGGTCGTTTCCGAAACTTGAATGCTGAATGCCACTTCAACATCGGCTCTGTCCAATCAGTCGGATACCGGTATACTGATCGA
AACAGTATGGTTACGTTCGTCGTAACCCTCTGTTCCGCATCGAGAAAGGCCGCGCGTCATGAGCTCCAGCATGGCGGCGTCGCCCGTGTCGCCGCTGTGC
AAGCCGCCGCCATCTCAAGCAGCGGGCGACCGCTTCGATACGGCATCGCACTCGCCTCGCGCTCTCGGTTCGCTCTCGCCACCGCGGTCTCCGCGGTCTC
CGCGCGCTCTGCCACCTGTCAAAGCCAGCGAATCCAACGGCATATGCTGCTGTGGAGGTCACTGCTCGACCCCTGCTGCCGTGGCGCCACACGCTCCGAT
GCCAGCAGACGACGGGAGCGTATCGACTGCATCGGGTCCTACCATGAGTCCGCGCTCGAGCCATCGCGAGCCGTCGCCCGATGTTCGGCAGCGTCTGCAC
ACGCTGCGCATTCAGACGGACTTTTCGACGCCGCAGTCGCCGACGAGGGCGTCTCCGTCATCGCCGAGACTCACGATACAAGATCTGTCCAAATGTGCCA
GCACGACCGACGACATCCCTTCACTCGCAGCATCGGCGCCGATCAAGCGCGCAAGCGCCACGGCCATCGAAGGCGTCGGTGTAGGGGTGGCGAGTCCGAT
GGCCGAGGCGCCGGCGGCGGCAATGACGATGCGCCCCAAGCCGCACCCGTTCAGCCTGGCAGACTTCCTGTACAAGGAGGTGTTCGGCGTGCACGACGTC
AAGGCGACGGATGGACAGCACCAGGAGCGTGTGCAGAACTTTCTGACGGTGCCGCTGCGCACCGAGCAGCTCTTCGCGTTCGGCGTGCTGCTCGCGCTCG
ACAGCTTCCTGTACGTGTTCACGTACCTGCCGCTGCGCATCCTGTTCGCGTGCGGCTGCGCCGTCACGTCCTCGTTCGCCACGACGCGCGTGTTCCGGCG
AACGCACTTCTACGACCTCATGGTCGCCGTCATCGTGAGCGTGGCCACTGCCGTGCTCTGGCACATCGACATGTCCCGCGTCTACCACGCCATCCGCGGT
CAGGCGATGATCAAGCTCTACGTGCTCTTCACCATGATTGAGGTGCGTTCCGTCGTTCATGCTCTACAATTGTTATCATTCTGAGTGTTTGTGGTTGTCG
CGCAGATCTTCGACAAGCTCTTGTCGTCGCTCGGACAGGACATTCTCGACTCGCTCTACTTCACGGCGAAGTACCAGCCGCGCCGCGTGCTGCGCATGTT
CGTCGACTTCGCCGTCGCTATCATCTACGTCGATATCCTCTCCACTTCTCGTTGCTGCATTTCGATATCGTCCCATGCTGTTCATTCGCCGAGCTGCCTT
GACTCCCGTCATTACTTCTCCACTCGTCGCTGCTGTTTGCGCAGGTCGTGACCATCAACGTGGCCATCAACTCGAGCAACACGTCGCTGCTCACGCTGCT
CATCTCGAACAACTTTGCCGAGCTCAAGGTCTGCCACCAGTAGTCTCTGTCATACGTCGGTTCGTGGACTCACTGACGTTGTGTTGTATCGTGTAGAGCT
GCGTGTTCAAGAAGTTCGAGGAGCAGAATCTGTTCCAGATCAGCTGCAGCGACGTCGTCGAGCGCTTCAAGCTGCTGCTTATCATCGGCCTCATTCTGCT
GCAGTCTCAAACGAGCGACGTGGCCTACGGCACGGTGAGCCTCTTTGTCTATCTGTTCTATCTGGACCCAATAGCTCACCTCGCTGTTGTCTTTGCCACT
ACCGTAGGCAATGGTCATGGGTGCCGAGATGGTCATCGACTGGCTCAAGCACGCCTTCATCACCAAGTTCAACCGCCTCTCGCCGACACTCTACTCCAAG
TTCCTCACCATTCTGTGTCGCGACCTCACTGGCTGGCGCAACGAAGACACGATCCTGGACCACACGCACCACGTCTCGCGGCGGCTTGGGCTTGTGTCGC
TCCCGCTCGCCTGCGTCGTGGTGCGCATGGTCGGCAAGTCGCTGCGAGACGCGCCAATCCAGCTTGTGTCGCCGAGCGGCGTCGCGCTAACGCTCGCCTT
CTTCGCGTGCCTCGCGGCCTTCAAAGCACTGCTGAGCCTGACGCTGATGATCTACGCGTGTCGGTCCGGTCGCCTCGAGGATACCCGGCCGAAGAGCCCT
CGCGCCACTGCTCGTTAGGAGCGAAGACCTCTATAGACACCATGTTGCCTTCCATTCTCTTTTGTGTTTTATCGTGTTGCTTGTTCTCCTAGTGATGATA
CGCGAGGGAGCGGCTCGCGCGCGCGAACACCGTCGCCGTCGCTGTCGCGGGACTTACTGCTACAATCTACTCGTACACGACCTGGTCCCGCTGCCTCGCC
TGCCTGGCGCTTCGCCCGCGCCGACCGCTCTCTCCGCTAGCTTTGATACATCCTTCCTGCCTAACATGCACGCTATCTCTCTCTCCTCTCTCTCTCCTTG
ATCTGTTTCTGACTTATCTACAAAACCAACAAGCAAAACTTGGACACGACCCACCATCGCCTTCCCACCTCACTCCTCCATCACGCGCGGCTCGCGGCAT
TCATACCCATACCGCTACCGCCCACCGCGTCAGGCATCGCCACGAGCCCACCGCTCGCGTACGGCCCGCCGACGCCGTTGTACACCGCGCCGTTCCCACC
AAACGCCAGCTGCGCGCCGCTCGGACGCGACGCATACATGCGGTGCACCGTGTGGTGGCCATACCCGCCGCCGCCGCCACCACCAAGCATCGGCATGCCG
TTCACTGCCGGGTCCATCACGAGCGGCTCGCCNNNNNNNNNNCACGTAGTTCGCGAATTGGTCTTGCAGCATCTTGGCGAGCTTCGGGCACGACGTAATC
TCCTTCAGGTACGACTGGCGCACGCGCTCGGGGGCCTTCTCGAGGCACTTCTCAATCACGTTCGAGCTGAACTTCTGCACCGACAGCTCGAAGATATGGC
CCAGCGGCTTCACGATCACGCCGTACGCCTCCTCGGCCGTGCACGAGTCCAGCACGTACTGCACCACGTAGTTGCCGTACGGATCCTGCATCAACTTCAT
CGCCTGGCGCTCCACTTGGGCAATCACCTCGCGCTTCTGCGTGCCGTTGGCCGCGTCCAAGCAGCGCTGCAGCACACAGCAACCATGGCGGTGCGTGCCG
ACCGTCGTGCACTCCTTGCACACTGCGTCGAAGACAAACTGGTTGTACTCGGGCTGCATGAACTGCAGTGCGCGCTGGATGACGTGGTTCCCGTTCGAGT
CGATGCAGAGACGAACAGCGTCGTCCTTGAGCGCTTCGACAATAATGTCCGGCAGGTTCACCACGCGCTCCTCGCCTCGTTCTTCGCCTGACTTGTCCAA
CTCGTGGTCGCTCTCGTCATCATCTTCGCGGTGTCCAACAGGCTCGACCACCTCGGGCGAAGTCGCACACACCTCGACCACCTTCTGCACCGACCGTGTG
CCGTGCAGGTTCAGCGCCGCGGCCACGAGGTTCGAACTCACGCGGCGGATGATCGCGAGCCGCTGCGGACCGCCCACGCGCTCGAGCAGCTTCTGGAACA
AGTAGTTGCCGAACGGGTCCACCATCATCTCGGCCAAATGGTCCAGCGCCTCTCGGTAGATCACGTCGCACAGGTCCGACCGGTCAGCGTAGTCGAGCTG
CTCTTGCAACAGGCGGCAGCCGTTCTGGTCCTTCGACATGGCGAACACGCGTCCGCGAATGTCTTCGACGCTGAGCGCGGCGCTCAGTCCCGCAGCGGCG
TCCGCCAGCTCGTTCGCGCTGTTCGAGCGGTAGTTCCCAAGCCGCGAGCTGCCGCCCGAGCGACCGAACGAATGGCCGCCGATCTCATCGTGGTGCGCGT
GGTGGTGGCCGCCCATCTGCGGCGGCGAGAGCATCACGCGACCGNNNNNNNNNNNNNNNNNNNNNNNNCCGCCATACATTTGCTGGCGGTGGAGCTGCTG
CGGCTGGCCCTGCGGCGTGAACTCGCCGCCCGGTCCGTGCGCAAACTTGCACTTGGCACCCATGCGACAGTGGCCCTGCAGGAAGAACTTGCACTGCTTC
ATGCCGAGTCCGTTACCGCCCTTGCGCGGCGAGTGAGGCGGCGACGACTCCGGCAGCGGCGGCGTCATTCGAGCGTACAGGTGTCGGGGTGTCGCGCGAC
CACTTCCTCCGCCTCCGCCTCCCGCTCGCATGCCGAGTGGCGCGTACCCCATCGGGCTTGGCTGGCCAGCGTTCATGTAGTCGTAGCCACCATGCAGTCC
CGGCTGGACCCACTGCGCGCCGCGTTGGTTGTTGTAGCTCGCATACCCGCTCGGCGGCGGCGGCGAACGGTACATCGCCGCCTCGTGGCGTCCTCGGCCG
TACTCGCGGCGGTAGCTCGGGTCTCTGGCGCTTGGTGCAGACGCGTAATACTCGTGGTCCGGGTAGAAGCTTGCATTGTTGCTCTCCGTGCCGTCCTGGC
TGCCAGACCACGAGTCTTCCGACATGTGCGGGCTCAGCGGCGGGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCTCCAGCGCC
AGCGCTCGACGTTCCCGGCACAGTGCTCGAGCGGCTGATGGCGAGCGGCGGCGGCGCATGGCTCTGACCGCCGCGGTAGTGGCCCAGCCGGCCGAACTTC
TTGGGCGACTCATCGAGACGGAACTGGCCAGGAGGGTACATGGGCTTGGTGTCTCGACCGGTCGGCGGGTTGCGGTCGTCCAGACTGAGCTTGAGGAAGT
CGCCGCCCAGCGCCTGGCTCGGCGACTGCGACAGGAACAGGTCGAGCGAGTTCTTGCGGCGTCGGGACGGTCCGGGAAGCATGGGGAGCGCCGGAGTCGA
CGCGACTGTCACCGGGATGGTCGCAACCGTCGAGACCGAGGACGATATCTCGTGGGCCTCCGACTGGTTCGTGGGCGACAGCGAGTGGGGCGGCAGCACC
TCGTTGTTGTCGGACGTGGGGGTCGAGTCCTCCGTCGGCTCGTCCTCGTCGTACTTCCTGTGGACCAAAGTGTGAGCAGAGCGTCGACGCAGAGCGTCCT
TGGGAGAGTGCGGCGGGACGTACATGGGCGTGAAGAAGTCGGAGGGACCGCCGAAGCCCCCGAAGAGCGTGGTTGAGTCGAAGCTCAGCGCCGACGGCGC
CGACGTCGGTCGTTGCGCGGCGTCCGCGTCACCCGCGGTCGGCCGCTCCATCCTCCGCTCTTCCTTGCTCAGCCCGACCTGGACCTGCCGAGCACCACGA