Description :
From Genome Similarity Track
Location :
Scaffold_6:1605768- 1608170
Sequence
2402 bases(100 bases per row)
CTCAATTCAGCGGATAGAGGAGCAACTTAAAGTGGACCGCAAAGCTGCTTATTCGAGCAAAGTGGATAGGGGCTTAGAGCGATGCAGAGTAATGCAGAGA
GCTGTGAGATGAGCTAAGCCTGAAGGAAGGGTGCAAGCAACAAGTGTCTACTTTAGATGTGCTGCACAATAGTGACTTTCCCATAGTTAAGCACGCTCGA
ACAGTCATGTTTGGTTACCTGTAATTATGTTTTCCATATTCCGAGGGAGGGGTGAGGTATTTTTATCTTAGGCTGAACAGATATTTTATACTTGTCGAGG
GTCAGGGATTACTACCGAAGGGCTCATCTGTACTTTATAATAAATTGTGTAGTAATGCTACTATGATCGGTTCCAGCGCAATAACCAAGCGTTGATCATT
AGTCAAAATTGAAACGTACCCATTTGATGATCGTACCGTGCAAATCAAATAATATAGTACGATACAATGTAGGATCTCGAGCTTTCCGGTGAATACAGAG
CTCTAGCTGCTGGAATAGCTCGTACCTCGAATGATCCTGGGTGGGTGTGACAGAGAAGGGGTGTCAAGTGTAACGTAATATTGCAGGTGAGGATAGTTGA
TACAGTGCAGACAGATGAAAAGTACTACTTGTGGTGTCTAAATATTGACATAATTCTTTAAGCATTAATAATGATATTTATGATCACTGAAATCAGTATT
GTATCATTAGCAATGAAAACCACCGAAATATGGAAATTTCGCACATTCTTTAAGGTTCGCGGACTTGTAAGCATACCAATAATAGCTACCGTCTTACCGC
GCACTAGACGCCTAAGCGTTCAACTAAAATAGAGAGCCCCATGGGCGTTTTATTCATGTATACAGCCTAGGCGCTCAAATGCAGAGATAAACTAAAAGTC
AGAAGAGCGACATGAGCAGGCGATCTATAGATGGAGTCCGTCGAGCTTCAAGGTAAAAAGTGGCCCAATTCGTGCTATGCAAATGTCTCGGGCGGCGCAC
TCTACAGTGTACGTGTACTTCGAGATAACTCTGCATTCGTTGTTAAGAGTGACGACTTCAATATCGCAATCGTGCATGCGAGATGCAGCAAATAGCTCGA
GCTCTCCAGGCGCAAGTTCACCACTTCTTAACGACGCAATGTACTCGTCGTCGAACAGTCCGGTCAGGTCATTTAGGTTTTGCATATACTCCGTCAGAGA
TACAACGTAGTCAGAGTCTGAAGCACCGAGACTACGACGAAGACAGCAAAACAGACTCGTCCGTGTGTCTTCTGGGATATACCAGCCTGGTGTTGAGATA
CAAAGTTCCTCGCGTTCATCCGTCGCGTCGACAATATGCTGATATTGTTGGTGCCAGTCGTACATGTTCATGGATGGGCTCAACAACTCCCGAAGTGGAG
GATACAGGTTAGCCAAACTAAACGCCGACTTAGCTACAAGCCCGCAAAGCTGAAATGCTTTCTTGATATCCTCCGGCGTTTTGGTATCAATCCAATCTAA
CACCCATTGTGCAACTCTGCCATAGTTAGGGACTTTGGGGTTGCCGGCTTTTGTTTGAAGCTGTTTGTCTTGTAGAGCCTCTCCAATGTAGCCATCATAC
ATCGTGCGGTAATAAGCTTAGAAGCTTCGATTGACTGCAACATCAAGTGGCTGTAGAAGGTTCGTGAGATTTGGAGGTACTAACAACACGAACACGTTGT
ACCGCTCGAGCAGTTTCTCGTTGAACATCTTGACGTGGGCTGCATACGAGTCAATGATATACAAAACGGTTTGCCGATAAAGTTAAGTCTCCTTCCTGCT
GCATATCACGTCTTGCGCATGCCTGAGAAGGATGTCATCATTCCACATTCCAGTGGGTTCACGTCTACCAAGACACCAGGTGGACATGATGGCCTCCTTT
TCAGTTTGGAGATGAGTAAGTGAGGCGCTAAAATCTGTCCGTCGCCAGTGATTGAAAATGTTGCAGTGAACCGTTTGTGACTGCTGCCGCTCTTCCGCAA
AAGCACTTCTCGTGAGCCACGGGTTGTGATGGTAGACTTTGGTTCTGTTTCAAAATATCTGGGAACCTGGTCCATATTGATCACATTGCACGGAAGGATG
TCGTGCTCTTCAATCAGTTGGTGTGCTTGCCTTATGAACTTCATGCACGTCTCTGCAGCGTCATCGGGAAGTGTTCTGGTGGTCGTTTGCCGTCGCGAAA
CAAGATTGTAGCGCTCCTTGAAACGATCCAACCACCCAGAAGAAGCACGAAACTCATTCGGTGGACTTCCACGCTCTATCAAAGCACGGTTGATGTTGAG
GGCTTGTAGCTGGATGTATTTGTCTTTTACTCGCAAACCCTTCTTGTTTCGAAAGGATACCCATGCGTGGAGTTCCTGCTCAAGCTGATGATAGTGTGGT
TT