Description :
From Genome Similarity Track
Location :
Scaffold_261:16054- 17460
Transcript NameFunction/comments
g10610.t1ETP05249.1 hypothetical protein F441_18123 [Phytophthora parasitica CJ01A1

Sequence
1406 bases(100 bases per row)
GTCGTACTCGGCCAGGATCTCCTCGGCCGACTTGCCCGACGTCTCCGGCACCAGCTTCAGAGCCAACAGGAAGAAAATCGCCAGCAGCACCACGAACGGA
ACGTACGCGTAGTCGTCCAGAGCGTCCGAGATGTACGGGTAAGCCACACCCACGATGAGGTTGCACAGCCAGTTGATGCCGATGCACAGCGACGACGCGC
TGGCACGGATCGAGTCCGGGAAAATGTCGGCCGTCATCACCCACACGAGCGGGCCCAGCGTCACGCCGAATGCGATCACGTACAGCGCCGTGAACACAAT
CGACAGAGCGGACACGTCCACGATGAACGCCACCGTCATGAGCACCGACATGATAAACATGCCAGCCAGACCCCACAGGATCATGTTGCGCGCACCGAAG
CGGTTGGCCAGCACGCCCGTGAAGAAGGCGGGCCAGATGTTGATGAAGTCGATGATCAGCGTGCCCACGCGCGAGTCCGAGATGCCGGCGTCCGAGAAGA
TGCTGCCAGAGTAGTAGAACACGGCGTTGATACCCGACAGCTGCTGCGCGCACGATAGCATGATGCCGCCGAGAAGCTGCATGCGGTAGCGAGGCGCGAA
CATCGACTCCTTCTTGGGAGCAGCCAGACCCTCCTCCGCGGTCTCCGCCTTCTTGCTCACCTGCAGCCACGACAGGGCCGTCTGCACGTGCTCCTCGCCG
TACAGGCGAGCGATTACCTCCTTCGCCTCCTCCGTGCGGCCCTTGGTCAGCAGCCACGCGGGACTCTCAATGCACATGGACGGCGCCAGCACCATGTAGA
TCACAGCCAGGATGCACGGGAATGCAGCCAGGTAGCGCCAGCCAGAGCTCGTGTTGGCGAAGAAGAAGCAGATCGCGGGGAACAAAATGCCGATCGTCGT
GAAGATCTGCAGGCCCAGGCCGAGCGTGTTGCGCATGTGCGGCGGCGACAGCTCGTTCACGTACGCACCGATGGTGCCCGTGGCAGTGCCCGACGCCAGA
CCGGCGATGAGACGGCCCGCGGCGAACGCCCAGATGTTCGACACGGCGGCTTCCACCACGCCGCCCACGAACATGAAGATGCAGTTGAGCATCAACGTCT
TCTTGCGGCCGAGACGGTCGCTGAAGTGGCCGCAGCACAGCGAGCCGATCATGGCGCCGAAGATCCACGCGTTCACGGCGAACGTCCACTCGAGCTTCGA
GTGACCAGGGAACATGAGGCACGTGTCCTCGGCCACGGGGCGAGCATTGCACTCGTCCGTGTCGTTGTACTGCGACAGGTTCGTCTGCGAGGTGGACCAA
CCGCTCTGGAACGGCTGCAGCCACGACAGCAGCGCACTCGTGTACAGGATGGCCTTGGGCTTGATGAGGCGCGCGGCGGCCTTGTTGGCCTCGTCGAACG
CCGTCG