Description :
From Genome Similarity Track
Location :
contig_38:160513- 185446
Transcript NameFunction/comments
g8329.t1hypothetical protein
g8330.t1RAW31866.1 Tyrosine aminotransferase [Phytophthora cactorum
g8331.t1OWZ24323.1 Dynein heavy chain [Phytophthora megakarya

Sequence
24933 bases(100 bases per row)
ACCGACTTCGTTTGGCTTACCGGTATTACGGTGCCCCACATGGTACCGCGTACCACCGATAAAACCCATAAAAAATACACGATTACCGTAGTTTTACTCA
TAACGTACGATATTTACTGGTTCATCATTGTACCGTTCATGAAGCTGTGTGTCTGTTCTGGCTCAATCATGTACACGTATTGGTCTTGCCTTCTCCCTCA
CGGATCACTCGCACGCCGTTTGCCGCACGCTGCTCATGATGTATCCAAATGAATGGCGAGTACACAACGTAATATAACCGTTATATTACTGACCATTATA
AACAGAGGCCAGCTGAAAAACCACAATGAGATATGATTGGATGACCGTTATAAGCAGATATTCGTAATAAGCCAAGGAAGTCGGTAACCCCAGATTCAAC
ATTTGAATGTCGGCTGAAGTGTAGTGCAGGAGCTATCCCTGTTGCCCAGTCCAGACATGGGATGGTCTGTCCGTGCGGCTCTCTCAAGTCTAACCATTGT
TGTCTAACTAAGCATTGCTGGGCGCACGCATCCTGTACGCGCTTCAATATTGTTCTCATGAACACAGCCAATTCGAAGGTGTTCTCGAAAGGTGTTGTTG
GGTACGCCCGAGGCTTCGCAAGCCCTCACTTTTCACTTCGTTCCGTCAAACGCACTCGTCCAGTCTCCAAGCTCCAGCGTCGCGCAAGTGCCATCCTCCG
CGGGAGGTGAGGAGGAGGGCGAGGAGGAGGAAGTAAAAGATCGCTGAAGGAGTCCCGACAGCCAATCCAAAAATGCTATTCTTTGCGGAACTCCCAGCGC
GGACGTGAGGCTCGAGGAGAATGCTCCGTCGACTCGAGAGCTGCGCAACGGATGTCACGTCATGCGACCTGAACGACGGGACTGAGCACCGTCCAAGTTT
GCTTCAAGACAAGACATAGCAGAGTGTCGCCGTGTGCCTATCTGGAGGTGGGGAGGGTTTGCATGGCGATAGCCGGCTCGGGCATGAGCCCTTTCGGGCT
CTGTAGGCTACGTAGGTACCTATAGGACGCTCTTCAGGGATAATGGGTTAATTATCCATCTGGAACTGTTAACCACGGGGCTGACGCTTCATTCCGCCTG
AAAGCATGGTCCTCTCGATCATAACTTCTCCATTGGAGAACGATATCGTCGAATCTTCAGTGCTTCGAATAACCTGCACCGTGACACGGTGCCAGACACA
TAGCGGCTGTGCCTTGACTGAAATGCAGCAGAAGATTTCCGTTCCTGGCGGGTTTTGTACGTCACGAGGGTGCAGTGTACAGCAGGACCTGTCTTCTGGT
CCGAGGGTTCCCTGGGTTTCAGTTCGGTTGCATTGAAGTTACCGTGTCAAAGCGATGTTGCAGCAATCGACTTGGATATTGCTGACCTCGCCGAGCTATC
CTACACGACGTCCGTCTCGCCCGCGGCCACTATCCTATATATATAATACCGAGGTTGATACTTGCTGCGAGGAACGTGTGTGGGATCGGTTTTCTCGTGG
GTTGCCTCGGCAGCGAGCGCTTCTCCATCCATCGTCGTGGAAGACCGCTCTCTGGAGGTCGAGACATGGTGTGACCCCCCCAGCTGGCTGCGTTGAGACT
TGCCCCAAGTCTCGATTGCAGGTGGAAATCTCTCTGCCGCATTGACCAAAATATCCTCATTCTTCAATTCACTTCGAAACCGGCAGTAACGACTGTGGGT
GCGGTTGTCGAGACCGGTTGGTAGCTGCACATGTTTTCCTTTTGACAGTCACAGGCCACGTCCTGCCGTGTGCAACACGCCATTCTCACTGTGATACTTG
TTGCTTTCTCTCGCTTGCTCGGTCGTTCCCATCTGTCTGCCTGCTCAGAAGAAATCTCGCTCTTCGACGGAGAGAAGACACGAACATTGACCCATTGGCA
GGTAGCGGAGTGCGGCATCTGGTGGATTTCCCTCGATCAAGTGAAGTAAGGAGGCAGAGAGAAACAGCGATATAAGAAGGGGGGAGGCCATGCCGGTTCA
AGTGCGAAACAAGTTGCCTGGCAGAGAGCACCTGCCGGAGAAACCCATGCACCAAGACTTCCCCGTGTTGTCCTGCAGCCTGGCAGTGAAGCCTGTCAAA
CGTAAACCGCTCGTGAAAAGCCGATTGGCAATGGTGGCCAACAGCGAGCGCGTCAAGAAGCCGCGCCGCCTTCCCGGCGATGAGACCGTCTTCTACAGCA
ATATATGGTCGCCACCCGAGTCCACGCGGGACGTGCGTGTTTCCAAGAAGACGACGCAGCTCGTGGACATCAGCCAGGTAGCGCACGTACTCACGACTAT
TGACTACAAGAGTGGCTACGAAGTCCCATCCGACACGGCGTTTTTCAATATCTGGGCGTCCATCGAATCGATACAGAATACCAAAAACGCCGCCATGATG
AGCAAGACGCAGCAGAGCGCCAGTAATATGTCGACGCCCATTTCCGAACACAGCAGCGAGGAATGTTCATCGGTGGTCACGTCGTCTAGTCAGTTGAGTC
TCGGGCCACTGAGAATGGATGCGAGCGCGCTTCGACGAGAGCTTTCAGGAGACGATTTTACCATGGTGATGAGTGCTCCCGTGTCCGCCCCGCAGCGCAA
GGGCGAGAATGTAGTGTTTTCGACAGTGTTAACGCACAAGGATGAAGTCGACATGAGCTGGAATTCGCAGTTCCTGCTGGGACTGCATGAACCAGTTCGG
CACGCGCTTTTCGTAATCGATCGCTTCTTGGAGCGCAGCCGGAGCTTGAAGTCGCCCATGAACTGGAACGTGGGCGCGTTTTTCATTTGGTTCAAGATGC
ACTTCGTCGAGTTTGTCCGAAACCAGCACGACGTGAAAACAAAGGTGCTGCTTCCGCACGTGGTTATCAAGTTTGTGGAGAAGCGTGATATCGTTGCCCT
GTACCAAGCTATTTTCACATTGGTGGATGTGATCGTTGAGCAGGAGGACGGATTGCTGCTATCAGCAGTCTCGTCAGCGGATTCATGGCAAGCTCGTTTG
GGTCTACTTCAGGACGATATCCGACGTCTCAACCACCTGCTTTTCAACGTGCTGGCGCTAGAAGAAGAAGCCTTCAAGCCCGCTATCGAGCTCGCATTTT
CAGAAAAGGCTTTCCAGCGGTATGTGATGCCGCGTATCTTTCGCGCGACCAAACCCAAGCGCGTTATGGTACCATGGATTGTGGAGCGAAGTCGCGTCTG
GGGTGGCACCAAGGTCGCTAAAGCGTATAAGGACGACCTGTCATTCACTGCGCGGTTCCTATATGACCACGTGTGGCACCCGTACTTTGAAGCGAATATT
GCATCTGCCATGAAACACCTGGGCAACGAAGTCGAAGGTATGGCTGCCAACGGTTTGGATGAGTCGTGGTTTGGATGCTCGGTCATGTAGTGAGTGACCA
TTAACACCGCAGGTGTGCATCCGAGAGATCATGACAATATCGGAGCAGTGCTGCTTCCAGCAATCGACACCAACAGAAGGACCGAACGTTCTCGTTTAGT
ATTTAAAAGGGAGCCCCAAATAAATTGTCGTTCCCTCTCGTTCGCGTTTGATCGGTCAATAGTTTTCTTGCCGAGTTGCTGAGGATAACCAACCGCAAAA
TAGATCAAATGATGGAATTGAGGAACTCCAACACGCGCTTTGCGACCAGGAGCTGCCTCGTTCTAAGCTTGATATCTTCCGTGCATTTGCTTTCCCCTTG
CGAGCCGCGGCTTCTGCTCTCTTAGCTGCCGCAATTCCTTTTCTAGCACAGTCACGTTATCCTGATTGGGACTGTTGATCGCCTTGAGCAACGCGGAACA
CACCGCGACATTCGCCGCATATGCTGTAGTTGTCGAGAGTACAATCTTCCTCTAGCTCGCAGCCCAACGGTTTGAGTTGCTGTTGGCTTTGCAACGCTGA
GCACGGCCTCGTGGAAGCTAACGTCTCCGGGTTGCGATGTTTCCGAGCGCTTAGCCATCATCCACAGCAGCGTAATGCATTTCAGGTCGTAGTCGATGGC
GATGGCGACTGACGCCGACTTGGACCCACCTGCACTACACGTAGTGTGCAACTCGCTCGTATCCGAAACGGAGCATCCAGTGGCGAGCGCCCGAGTCCTC
CAAGCGCAGCCATTGCGGGCTACGCAAGCGTTGGCACGTCTTGCAGTGACATCCATGACTGCAACGTCAACTGTCGAACATATTGGGCACTGTCGGTGTC
GAATCGAACATATTGGGCACGTCGGTGTCCCGCGCAGTGCCAGCCATGCTTCAACTTGGTGTGCATTCCACACTACTCGATGTGCGGTACACAAATCTTA
AATCTGCGACAAGGTTCACACCATCCATCCCAAAACCTGCGCGTAACGAGTGCTTGGCGCAATGAGCGAGGTGGCCGAGAATCCGCCAACCAAGCAGGAA
GGAACAGCGCTGCAGCCTCCCACGGACGCGCAAGGACATCCTGTGCGCGAGTGGATTGACACGCTGCTGCAGGCGGCCGGAATCGCCAAGGACAAGCAAA
AAACGCCTGCGCAGAGCGACGACAAGGCCGCGGTCAATCCAACAGACGCTACGGCTGCACCCGACGACGCTAGTGTATCTACTACTGTTGCAGATGCAAA
GGATGCTGCTGCAACTGATGCGACAACGAGTGAATCGAATAAAGAGGACGAAGACAAGGAGTCGTCACCGACGGTCTCCGATACAAAGGACGTTTCAATG
GACCCTGCTGCCGATGAAGCAAAGCCCGGGGAAGGAGCTTCTGCTCCAGCGCCGAAGCGATACCGCCGCCGGAGATGTGAAATAGAAGGTTGCTCCAAGT
TCGCGCGCTTTAACAACGCCTGCTCGGGGCATGGCGGGCGGCGTCTGTGCGCGGAGGCAGGCTGCGAGCGCGTAGCGCAGTTTGGCCACAAGTGCAGTGC
ACACGGTGGCATCAAGTTTTGCAGCGTCGAGGGTTGCCAACGTGCCGTGCAGTCTCGTGGCTGCTGCAAGACCCACGGCGGAGGTGTGCGGTGCCAGTAT
CCCGACTGCACGAAGGGCGCCATATCCAAGGGCTTCTGTCGATCGCACGGTGGTGGCTCGCGCTGTGCCGAGGAAGGCTGCGAGAAGTGGGCCCAGCGCC
ACGGATACTGCGTGCGCCACTCGAAGTCATCGTCTGCTCCGAAGGCGACGCCTATCCAACGAGCACGGGAACCCTCTGGTGACTCGACCGTTCCATCGCC
AGAACCACTACCGAATAGCGCTTCGACTTAGCATCCTATCCATAGCACAGCAGGAAAGCGTCGCAATATGAAATTGAGAAAACATCATGCTGTGTGCACC
ACACAATGTTTGGCATCACAATGGCGCGCGACCCGGTCTGCTACGCTGGCTTCGCAGTGCAATGCATGGCACCAAATCAATTGCCAAGGTTCGCTCCAGA
GTCCGTTCACTTGCTGGAATCCTACGCGGCACATCGAGATACTGGTGAGAGAAATGCGATCTTTGGGTGCTGGTTGCAATGCCAGGAGCTCTAACACAAC
GTGTGCAATGAATTAGTGGTGGATATCGCGTGCAAAGAGCGATCGAGTGACTGCTACTCCGGCAATGAGAAGGCCAGACAAAGTGTAGACCTGAAGTTTG
GCGACTTCGTGGACTACTACCAAGCGACGTTCAGGAAGCAGTCGCATTGGCTGCAGACGGTGGGTGGCCTGGAGTTTTATTTGGCGCAGTGCCCCATTGC
AGTGCCCAAGCCCGATGCTACGTGCACCAAGGCAAGTCTGCCAGCCATAATGAACCATTTCCGCATGTAAGGTGGTTATTCTTGTCATCTCTTGAGCCTG
CAACTCTGACGGGCTTGTTTGTGGGCTTGCTACTGCAGACCGGCATGCCTTCAAGGCAAGTCTGTCACCCAAGTGAACCTGTGGATGACCGTGCAACCTG
GCCGGACGACGCTGCACTACGACGCGTACCAAAACATCCTAGTGGTGTTGTATGGGAAGAAGGTTGTCACGCTGTATCCTCCGTCAGACACCGCTAAGAT
GTACCCGTACCCAGTGCATACCAAGTCTACAAATCACAGCCAAGTGAACATTGTTCAGCCCGACTTCGCAAAACACCCACGCTTCAAGGAGGCGTCGGCG
CAGCGCTTTGAAGTCGCTGCTGGAGGTATTGCTGATTGTTTTTATGAGCGGTTTACATCCTATCCTTTTTGTTCAGCCGTTGATAACAACTAAGGCGTTG
TTAACTGTCCTCTGCAGATGCCGTTTTGATCCCGGAGGGGTGGTGGCACCAGGTGGACTCGGACGAGTTTACCGTTGCCGTCAATTACTGGTGGAATGGC
GTGCGAGATCAGCTCGTAGAAGACCCACGCATGGCGCCGTATTACGGCCGGGTTATGCTGGAGGAGCTAGTGAAGCAGCAGTGCGAGTCGCGTCTGTCAG
CCGTGCGGTCTTCAGCGGCAGCAGGTACCCAGAGTACATTCCAAGACGAAAGAAGAGTGGTGGCAGCTATTGTTGCAGCAAACTCTCAGGAAACTCGCGA
GAGGATTTTTCTATCGCTGGACGCCACCACCTTCGTAAAAACTCAGCGACTCCTGGCAACGGATCATGCCCCATGCTGGCGGGAACTGCTTGCGAATGCT
AGCGTGGACTTGGTGATGGTCTTGGCCGACTGCTGGGAGAGCGATGACTTTGAGGTGGATCTCCTTGGTGTGCTGTTTGGTGCTTTAGAAAGCGAGGAAG
ATGCGGTCAAGGAACAACTTGTGGCCAAGCAAGCGCAGTTCCGCCGAGAATGCGCTGTCGAAATGTACCAGTCGCTATTTGGCTGAGCTTCAAGCACCTG
TTCAACGTGAAGCCGTTACCCTAGGTTGAACTCGGGGCAGTCGACCAGCGAAAAGCAACTTGTTGAGCGGCGGCAATTGGCTGAAATTAGTCCAAATGAC
GTCGGTGCCCGTCAGCGCGGGTAGATAGGGCAGAGATTGCCTTTTGCGTCTCTGAGACGCCGTCTCAACAACAAGATTAGCCTGAACTGGGATGGCTCAA
CCAGACTCTCATTTCTTAATTGACCGCTCAACTCAAGTGTCTTCTGTCGTCATGACCAAGCGTGCCACCTTCGACGATCCTGCCTTTGACGTGCCGATGG
TAGATGTCAAGCGTCAAGCCAAGCTCCAGTGGAATGTCCAGCCGTCCGACTTCTCCAAGCTGTGCTCCAACCCTATTCGGAAAATCGTGGACAACATCAA
GAAGCCCGCGACGTCGACCAAGACCCTCATTCCATTGTCGCTAGGTGAGTGACCCTGTTTTGCGGGTAGTATTTATTTTTCAGAGCTAATCGGGAAACAT
TCGGCCGTGGCAGGTGACCCCACGGTGTTCGGCAATCTGCACTGCCCCGATGTGCTCGTCCAGGCGATCGTACGAAACACCCGGTTCGTTGAAAGCATGA
CTTTCTGTCTAGCCGTTCTCGGCGCTGACCTTACTGTTTCTCTTGTTGCTTCATCAGTTCGATGCAGCACAATGGCTACATTCATTCTGCTGGCTCCGAG
GCAGCTCGCGCAGCAATTGCCCAGCACTATGGCAATATGAGAGCTCCGTTGACTATGGATGACATTATTATCGCCAGTGGTTGCTCGGGGGCTATCGAGA
TTGCTCTGCGAGGTTTGCTGAACCCTGGTGACAACATCCTTCTCCCGAAGCCAGGATTCCCGTTGTACCAGGCTCTCTGTGAAGCGCAGAAGATAGAGTG
TCGGTTCTACAACTTGAAGGTGAGCTGCTCTGTCAACTAGTATACAACGTTCCCTGTTTGCTAGACTAACGAATTATGCGATCAATGCTTGGACAGCCGG
AGAGCAACTGGGAGGTCGATCTTGAGCATCTCTCGACTCTGGTGGATGATAACACCAAGGCCATCCTGGTGAACAACCCTTCCAATCCGTGCGGCAGTGT
GTACTCGAAGGTGGGTAGTGGTGATGGTTTATTGGCGCCATTTCGTGGCCGTCGCGATTTTGTTTTCAAGTGTCGTAGAGGGCTTCAATCTCTAACGTTC
TGCATTTGCCGTGTCGTATAGCCCCACCTGGAAAAAATTCTTGCTCTTGCGGAGCTGAACAAGATCCCCATCATCGCGGTATGCTCGTTCCTCCATATTT
CCTATTGCATTCGTGAGTCTGACTCATTCCAATTGGCAGGATGAAATCTACGGCGACATGGTGTTTGGCAGCAACGTATTTTACCCCATCGCAACTTTGA
CGAAGACGGTGCCGGTCGTGGCCGTGGGCGGTTTGGCCAAGCAGTTCCTTATCCCCGGCTGGAGGGTTGGTTGGGTCATGGTGCATGACCGCAACAACGT
CCTGAGCGACGTGCGCACCGCCTACTTCAAGCTGTCGCAAAATATCCTTGGTGCAACCTCGCTGGTCCAGGTAACAAAACGACATTCGTCGCATCTCATG
GCTGCTTGAACGACAGCTAATATGTCCACGTCGTTTGCCTGTGCTGTCTACAGAGTACCATCCCTGATCTGCTGACCCCCATTCCCGGTAGTGCCGAGGA
GCAGTCTCTCATGGACTTTAAACAGCGGTACTTTTCGACGCTGGAGGCTAATGCCAAATTCACGACCGACACCCTAAGGAAGATCCCGGGCCTGGAAGTG
GTGATCCCGCAGGGCGCGATGTACGCGATGGTACGCAATATCCGCAACCGACTGCCCACCAATATCCTAACTGGCACCTATGCTCTGTCGTCTACAGGTG
AAAGTTCAAACGGACGTGCTGACCAAGATCAAGGACGACTTTGACCTAACGCAAAAGCTGCTGGACGAAGAGTCCGTTTTCGTGTTGCCCGGACAGGTGC
GTCCCAACATCCTAATTGTAGTTGCTGGATCCTTGGCTTGGCTAACCTGTGCCTTCACTATCGTGCTGCCGAAAGTGCTTCGGACTGACAAACTACTTCC
GCATCGTGTATTCGGCGCCGCACGAGGTGCTCGCGGACGCCTACACGCGCCTCGCCGACTTCTGCTGCCGCCACCAGTAGCCTGAATTTACTTTATAATA
GGGTTGAATCAGGCAAACAGTATGATGTTTATTTTCGTCCAATCGGCGTTCTTGGCAAATCGCACGTAATTTCCCAATACTGATAACCTTTATGGACACA
TACTTTGTTGTACATTGAATAGGACGGGTAGAGAGAGGGCTAGTAGGTCTACACTCTCAAAATAGATTCTGTATCATAGCCACAGTCCCTCTGTATTGTT
ATGGGTGCACCATCTGAAAATTCTCTGTTCGGAGGGAAAGACTGTCCGCGACTAAACTGAATTTGCTCGCTGCCCGGGGGGACGCCATGACTGGACGGAG
CTTCCTGCTGCTGGCCGTGCTGGCCTTCGCCACGCTGCAGCACCTGACGGCAGCCGCGGCCGTCGACGGTGTCATCGTTGTGCGCGGCAACAAGATGTAC
AATGCCAAGACGGGCGAGCGCTTCTTCATCAAAGGGGTGCGTTCGAACGGCACGAAAAGAGGATAGGAAGGAAGCGGCCAACTAACACCAAAGAGCACAG
TTCAGCATAGTAAATCCTAGTCTAATATGTGTGTGATCCTGTAGATGACGTACGAGTACGCCGTGAGCGATGAATACTACGACAAGTATTCGAAGGCTGC
GATCTCGGAGCACCTCTCGGGGCTCAAGTACAACACGTTGCGCCTGTACAACATCAACCCGTCGTCCTCGTACAAGGAATTCATGAACGACATGGCCGCG
CTCGGCGTGTACGTGATGGTTTCTGCCTCGCCCGATAACGACGCCTACTACGGCAAGTACCGTTACTCGACCATCACCAAGGGTCTCAGCTGCTCCGGCA
AGGTCTCGTCTGGAGATGGCGCTAAGACGGTGGATCAAACGGAGACCTGCTACCCAGCGCTGCTGCTTGAGTACGGCAAGAAGATTATCCAGAATTTTGC
GCAGTACGACAACACTCTCGGTGTCGTCGTGGCCAACGAAATCATGCAGGCGGACCTGACGGCCGGCTCCTGTGTGAAGGCCTACGTGGCGGATCTGAAG
AACTGGATGACGGTGAACGGCAAGAAGATTCGTATCCTGCCGCTTGCCTACGCCGCTGCTGACAGTAGCAACGATGAGGTCTCGAACGCGGACGACTACC
ATGTGATCAAATCCAGGGACTGCTCTGTGGAGACAAGATGACGAAGGGTATGATGACGGAGAGTATTGATATCTACCTGATTAACGAGTACCGTTGGTGC
CCGGACTCAACCTTCGCGGAGGCGTATCAGCGTTACATCGACATGGCGCAAGGCATTCCCATCGTTGTCGCCTTCGGCGAATACGGCTGCAAGACTTCTT
CGGCAGCGGCTCGCGACTGGGGAATGATTCCTTATCTGTACCAAGAGCCTTCTAAGACGAAGGAGTTCACGGCGGTTTGGTCCGGTGGGCTGGCGTACTC
GTATGGTGAAGCCAAGCTTTCGTCTGACTCGCTGTTCCCGATGTTCACTGGTACAGCTCAGCTAGTTCATTCTTGTATACTATAGCGCACGGTGGGCTCA
TGTTGTGTCTGCATGTTTAGGTGGCAGCACGGACTTTTTGAGTACTCCCAGCTCCAAGTCCACGACAGATTACACGAATCTGAAGGCCATGTTTGCCAAA
TACTCAGGCTATACGGATGATGCAGCATGGACCGACAGCACGAAGTGCACGTGGGCTCCTACCCTTGAAACCAAGACGCAGTCGACCAACGAGCAGGCAA
CGAAGTACGGCTGGGTTGTAAGCAGCTGCTCTTCAGATCACATTAAGATCTCTAGCTCAGACTCATGGACTTGCTCCAGTCGTGAAGGCGTGGTCTGCAC
GGACAGCGGTGCTACATGTGACGTGAAGCTGAGCTCTGCTGTCGGAACGACCCAGGAGGACATTTGCGGCACGTACGAGGTTACGAGCGGTGGTGGCACT
TGCGAGAGCACGTCCGACTGCGGCGGCAACGGCCAGTGCAAGGAGTCGAACGGTACCAAGTCGTGCAGCTGTCTGTCGTGCTACACTGGCACCGACTGCA
GCGTCAAGGATATTTCCTCGTGCGCGACGCTCAGCAGCTCGGACACGGCCCCCCAAACCATTTTCGTGGGCGTTGGCGTGTTCTTGGGTGTCATGGCGGT
TGTCTTCATCGCCCTCGGTGTCGCAGCGGCTAAGAAGAAAGCTGGTACGTGCCTTGTCGGAAGCCCATGCTAATATCCTATCGTCAAACTAATTGTGCTC
TTGCATTCACAGAAACGGACAGATTGGCACAGGCGGTGAAGGCTGGCGGCACCAACCAAGCGACTGCTGCTGCTCTGTAGACAAGAGACGGCACTAGATC
GTCCTGTATTGTGGCGGGCTCTACGAGCGCTGTGGCCTACCTACCCAATGAAACTTTTCATGGTTTATTTGACACCATCATCACCCATTATCTGAGCCCT
TGCCAAATAACCCTCCGTTTAGGTCCAGGGCTAAATATCTCAGTGATTTAAAGCCCGCGACGAAAAGGGTTAAATCCGCAGCAAAAGCTCACGAGCGCCA
TTCGTCTAATTCGTCTAATAGCAAAGAGAGACACGAAGCACCCGCACCATGCCGCCGAAGGGAAAGAAGACCGAAGAGGTAGATAGACCCAGTAACGTCA
CTGCAGGTGGGGACGCCTCCTCTCTCTAACTCTTATGCTGTCGTCCTCCCTCTCCACCCGCAGACCACGCGCACGTACCTGGGCCGCCCCGGTAACAACG
TCAAGATCGGCATTGTGGGTGTCCCCAACGTGGGCAAGAGCACCTTCTTCAACTGCCTGTCGAAGCTGCACATCCCCGCCGAGAACTTCCCCTTCTGCAC
CATCGACCCCAATGACGCCGTGGTGCCGCTGCCGGACCAGCGCTTCAACTGGCTCGTGGACAAGTACCAGCCCGCCAGTGTCGTGCCGCCCGTCATGTCC
ATCACGGACATTGCCGGCCTTGTGCGCGGCGCCGCCGAGGGCGCTGGACTGGGCAATGCTTTCCTGTCGCACATCCAGGCCGTGGACGCTATCTACCACA
TGGTGCGCGCCTTCGACTCGACCGAGGTGACCCACGTGGAGGGCAACGTGGACCCGGTGCGGGACATGCAGATCATCCAGGAGGAGCTGCGTCTCAAGGA
CATTGAGCGCGTCAAGAAGGAGTCCCAGGGCGTCAAGAAGCTCGCGGAGCGCGGCGTCGGCGGCAAAGAGAAGAAGGTGGAGTACGAGTCTCTGGTCAAG
ATCCAGGAGTGGCTCGAGTCCGGCAAGGACGTGTCCTTCGGCACGTGGAGCGCCCCGGAAGTCGAGCTGCTCAACACTATGCAGCTGCTCACGGCCAAGC
CCGTGGTCTACCTCATCAACGTGAGCAAGCGCGACTACCTGCGCAAGAGCAACAAGTACCTGCCCAAGATTGCCGAGTACATCAAGGAGCGTGGTGGCAA
CGAGCCCGTTCTCCCCATCAGTTGCGAGTTCGAGCTGGAGATGCTGGACCTCGAGGCTGGTGGCGAGCTCGAGACGTACCAGAAGGAGAACCCGACGCAC
AAGTCCATCCTGAATCGTGTGCTCCGCATGGGGTACCACGCCCTCGGTTTGATCCACTTCTTCACGGCTGGCAAGGACGAGGTGCGCGGCTGGACGATCC
GCAAGGGCCGAATGGCACCCCAGGCGGCTGGAGTTATCCACACGGACTTCGAGAAAGGCTTCATCATGGCCGAGGTGCAGGCGTTCGCTGATCTGAAAGA
GCGTAAGTTTGTCTTTTCTGTTTGTGGTGCTGCGCGGTGCTGTTGAACTTTACTAACTTTACGTTTTGGAATTGTGCAGTGGGCACGGAGGAGGCGGTCA
AGAAGGCTGGCAAGCTCAAGCAGCAGGGCAAGAAGTACGAGGTCCAGGACGGCGACATTATTTTCTTCAAGTTCAACAACTAGGTAGGTCAACTGCTGCC
GAGTGGTGTTGAGTGAGTCGAGCAACCGTGGTGCCAAGACCTCCGTTTTAGCCATGTGTGGCCTGTGGTTTTGAGCCAAGTGGCAGGTAATGTCTTCGGG
TCTAGAGCATGCGGATTGAAAAGCGCGGTTGCAGAGCATCCCGCAATGAAATAAAGCATGCGCTTTGAGCACACTGGTCTACCACAAGCAAGTTCACACA
AGGAGCAAGTGCGCTGTGTTTGGTTTTGGTTGCAGGAATAACGACTTGGAGCTGAAGGGGCTGCGATATCTTGGATTTGCCTTGACCCGTCGCGCCTCTT
GCAACTGATCGCGTGGAGTTTTCACTCTGTGGCCTCCACTTAGCTCGGCGGATACGGCAAAGCACACAAGCTCCAAGCCGAGGTGGTTTCGGTGTCGAGG
TGAACCAAGTGGAAGGAATTCCGTCAGAGCGTCATCTAGGCAGCCCCGGAAAGGGCAGAGCCGAAATGGTGTGTCACCTGGCCTGGTTGTTTTGTGCCTC
TGCTGATTGAATCGTCTTATTGAATATGTTGTTGGATGCTTGGTGTTGACAGCCTATCGGGTATGGATGCGAACCAGAACTAGCGTGGATTGCGCCGAAA
CAGAATGGAGAAATCCCTGTCAAGCGATCTGGGCACTCGTTCACCTTGAAAGGCTCGGAGACGGAGACTTCTGTCTATATGTTTGGTGGCTGCGATCATA
AATCGCCACCAGGACCGACGAACGAGCTGTACAGGCTAGACGTCACAAACGGTAGGATGATCTGCAGGGTTAACCTTTAGTAATCAGAGAGTAACTCGAT
TTTGCTGCAGGTTACACGTGGTCGAAGGTAGCAAGCTCACAGAGTGAAGACGATGTGCCAGCGCCGCGATGGAGGCACTCAGCCATCCTATTTGAGAAGA
ACATCATCATCTTTGGAGGCTTCGCCGCTGAAAAGCGAATGAATGACCTCTGGCTCTTTAACACCGAGCTGAAGGTGTGGGAGCAGAAGTATGCTCAAGG
TTTTTGGGAGGGGTTACCGCAATGCCGCGGTGCACACAGTGCCACTTTGGTAGATGAAAAGATGTACGTATTTGGTGGCTATGGCGGCAACGGCTTTGGG
CGTACCGACTTCAACGACCTTCACGCGTTGAACTTGCACTCATTTAAGTGGCAAGAGATTCAGACTGAGGGTGAGAAGCCTGAGCCACGATCGGGCCATC
AAACGTGCCTTGTGAAGGAGCAACTGCTTGTCATCGGAGGGTGGAACAGCTTCAAGCAGTTTCAAGATATCTTCGTTTTAGACATACCAACCAAGACATG
GAGCTTGCTGAGCACGTCGCTTCATTCTCCAATCTGGAATCACACGTGTGTGAGTGTCGCCGCTGTGCCTTACTGGAAAGTGTTCTTATTTGGTGGAAAC
AGTGGAGATCTGGCCGAGTCTGGAACGGCGCAAGGAGCTTATTTGAACAGCACTGCTGTGTTGGATACTGGCAGTATGGTATGGCTAAACCCGCCTGTCA
AAGGAGAGCCTCCGAAGGCCCGCGCTGATACTGCGATGGTGTTTGATGCAAATACCAATCACTTGATCTTCTTTGGAGGATGGGCAAATCGCTGGTACAA
TGACTTACACGTGCTTAATGCAAGCGAGATCGTTGGGCCGCCGTACTCAGTCCTGTCGATCGAACCAAGGCAAGGTCCGATCACGGGAAATGCAAAGATA
AAAATTTCTGGCTTCAACTTCACTGGCCAAAACGCTACACTGCGCTTCGCAGTTGCGAAAGGCTCTGTCGACGTCACGGGAGCCGTTCTCAGTCCTAGTG
TTATTCAAGCTACAGCTCCCAGCTTCGAGAAATTTGGACCGTTGACTTCCGAGGTTCGAGTGTCGTTGTCCGGGGCATGTACACAAACGTCTCCACATCC
TTCCGTTTTCACTCCGTCACAGCAGCCCCAAAGTCGCTAGCATTTGGTCCATGCTTAATTGCTGCCCTCAGTGATAATTGCCTGGCTGAGCTCCCGACTA
CATTTATCATCCAGACCAGAGATAAAGACGATAATCCGCGTGATTGTGGAGGGGATGAGTTCACCATTGCTCTAAAGAACTGTGATGATGCCGAAGCCGA
AGTGGAGCTGGTTGCATCCATCCTTGACAAAAATGACGGCACCTACGTGGTGACATTTACACCATCTAAGGCAGGCAAATACGAGGTCTCGGTGGATTTT
ACTGGCACGTTTAGTGGTGTTGCAGGCCCAATTCGCGGCTCACCGTTCACCGCGGTATTCCAGCCGCCATCGGATGAGAATAAAACAAAGTGTTTGCCAC
CACTTGCAACTCAGAAGGACTTTGACTCGCCAGAGCTGATCCGGCGTGTGATGGCCACAATGAACAAGCGCAACGGAGAATTCCGGCGCATTCTTGTTGA
CTTGCGGAAAGACATCCCGAATAACGATACAGACGGCCTTGAGACTCTGCGGAAGATGAAAGAAATTATCCGCAAGCTAGAGACAGAAAAGGCAACGAAT
CACTTGATTCTGGACCAAGTGCGGCAGCTATTCTTCAATATCAAGAAGAGTGGGGGGCATGTCGACAAGGAGCTCGTAGAAATCGAGAATATGGAGAAAC
TTTTTGTGGACGTCGAGAAGCAGATCCCAATGACCGAGAAGCGCACCCAGGAACCCACGCGGATTTTCAGCGAAAAGACAGAGGAGAAGATTATCGCGTA
CGAGAAGATGATCGCACAAAAGGTGGAGACTCTCAAGACGCTCGATTTCTGGTCATCAAAGTTGGAGCCTGACAAGGGTCTTGAGAAAATTGAGAGTTAT
CTTGTCGACTGGAACGTGGAGATGAAGAAGTGCGAAGAAAACACTAAATTGTGTTCGACTTTCGGGTTTCCGCAACTAATGAATGAATCGCTTCGCATGA
TGGGTCTGATGCGGGCAGATGCAGATGCAATGAAAACCGTATGGGCAATCATTAAGCGTGCAAAAGTTTTTTTCCAGGCAACCCAGGACTTATTGTTCAA
AGAAGTGGACGTGAATGCGCTGCAGATTGAAGTTCAGTCTGCATTGAAAGAGCTCAAAAAGATCCCCAAGGGGATTCAGTGGAGCGATGCGTACACCTCG
ATTTTGAAGGAATGCCAAGCATTTGATAAGACGCATCCACTTATTCGGTGCGTGTCATCCAGCTACATGCGACCTAGACACTGGAAGCGTATCATGGCTC
ACACGGGAGAGTTCCCTACACCGGACGAAGACCCAGAACAGCGGCTATCCCTGATTTTGAGTAAGAATCTGTTCAACTTCAGTTCGGACATTAATGAGAT
TTGCTATGAAGCTGAGAAGGAACAGGAACTCGAGCTTAGGCTTATTGAGCTCGAGGCACTGTGGGCAGAGGTCAATTGGGAGATGTCTCCATACAACCCC
GGTGCTGCCGAAGATGACATTGTTCCTCTCCTCAAGGTGTCTGAAGAGAACTTTGAACTCCTGGAGACGCATCAAATCGATGTACAAGGCATGAGCGCGT
CACCGTATCAATCTGAGTTTGAGCCTCGCGTCGCGAAGCTTCAGATCGGACTTTCATCCATCAACGAAGTGGTGCTACTGCTGGGTGACATCCAGAGGTC
GTGGAGCTACTTGGAACCGTTGTTATTCAGTCTGAAGAAGTGAAAAAACAGCTACCGGAGTTGACCTCTGACTTTGAAGATATTGATCGAGAGGTCCGAC
AAATTCTGAAGACAGCGTGGAAAACGCTAAATGTGCAGGAAGCGTGTACCGACCCAGGTCTCATCAAACGATTGGAGCTTATCGTGGAAAAACTAGAGCT
ATGCAAGCACCGCCTGAAAGAGTTCCTGGACGGGCGCCGCCGCCAGTTCCCACGATTTTACTTTATGTCCGAAGCAGACTTGCTGGATATCCTGTCGAAT
GGATCTCACCCCGACCGGATTATGCCGCACTGCTCCAAAATCTACTTGGCGACCAAGACGCTCACTTTGGTAGATCGTGGCGCGGGAGAGCGGCCGGTCG
CAACATCTTTCGTGGCTGGTGTTGGCCACGAAATTGTTGACTTCTTTGAGGCCCCAGTGCTTGAGGGAGAAGCAGAAATTTATCTGGAGACTATCATGCG
TGCTATGAGACTGACGTTGTTCAAGCATATTGATCGATCGCTTGTAGCTTACACGGAAATGCCTCGTGTAGACTGGATCAACTTTAAGGATGACACAAAC
AAGCCGATGGATGCAGCCCAGATCATTCTACTGGCAGCAGGAGTGCATTACGTTCAAGAAGTGGAGCGTGCCTTCCGTAGCATTCAAGGTGGCGAGAAGG
ATGCCTTGAAAAACTACAACAAGATGCAGGAGCAACAGCTAGAAGACCTGATTAAGCTCACGCAAAGTAATATTTCGTATGCAGAGCGACAGCGAGTGAT
GGTACTTATTACGATGGACGCCCACGGCCGAGATATTGTAGCAAACATGATTCGTGCCGGAGTGGAGGAGGCAACTCACTTCCAGTGGCAGTCCCAGCTA
AAACACTACTTTTCACCAGCAGCGGGGAGCTTCTTGAAACGTGATAGTACATTCCGTGGAGCAAACAATGCTCGAGCTCAGATTTTAATTTGTGATGCCG
GTATTCCGTACGACTACGAATATCTTGGAAATGGTCCCCGACTGGTGATTACCCCACTGACCGATAGAATTTACGTGACGGCAACGCAAGCACTGAACCT
GCAAATGGGATGTGCCCCTGCTGGTCCAGCTGGTACGGGTAAGACGGAGACAACAAAAGATTTGGCTAACGCACTGGGGAAAGTGTGTTATGTGTTCAAT
TGTTCCCCCGAAATGGACTTTAAGAGTTTGGGAAACATTTTCAAAGGTCTTGCATCGTCGGGTTCGTGGGGCTGCTTCGACGAGTTCAATCGTCTCGTGC
CAGAAGTGTTGTCGGTGTGCTCTGTCCAATTTAAGGCTGTATGCGACGCGTGTAAAGCTGACGACGAGAGATTTATCCTTGAGAATGACGAGGTGATGCT
TGATCCAACAGTTGGTGCATTCATTACTATGAATCCAGGCTACTTAGGACGCTCTGAGCTGCCCGAAGGTCTGAAAGCGTTGTTCCGCCCGATGACTGTC
ATGGTGCCCGATCTGGTGTTGATCTGTGAAAACATGCTTATGGCAGAAGGGTTCACCCAGGCCAAGATCTTGGCATCAAAGTTTTACGGTTTGTATTCAT
TGCTAGGGCAACTTTTGTCCAAGCAGCTGCACTACGATTGGGGCCTTCGAGCTGTGAAGAGTGTGCTATGCGTTGCCGGCGCATTTAAACGTGCAGAACC
AGACATTCCTGAAACGGACCTGCTCATGCGCGCGCTGCGAGACTTCAACATCCCTAAAATCGTTGCTGAGGATATGGTTGTTTTCTTCGGTCTTCTCGGA
GATCTGTTCCCGCGTGATAGTCCGAATGTGGACGTTCGGAACGACCCTCCGCGTAAGCGTGATATGGAGCTTGAATCCATGGTACAGGGCGCTTCAGAAG
CAATCGGTAATACACCTCGCCCAGAGTTTATGCTGAAGGTTGTGCAGCTGTCAGAATTGTTGGCGATTCGGCATTGTGTCTTCGTGATGGGGCCACCAGC
TTCAGGTAAAACAGAGACTTGGAAGACGCTGAAGAAGGCTCGCGAGATCATGGGCACTCCTATGGAAGTCCAAGACCTAAACCCAAAATCGGTGAGCACG
AACGAGCTTTACGGGTATATCGTGCTGAAGACACGCGAATGGAAAGATGGCTTGCTGTCTCGAATTATGCGAGATCTGGGCTCTCGTCGCCGTGATAATG
GTGATGAAGACAACAACCCCAAGTGGATTATTCTTGACGGAGATCTTGATGCTAACTGGATTGAGTCGATGAACTCAGTCATGGACGATAACAGAATGCT
TACGTTGGCCTCGAACGAGCGTATTCCACTGAAAGTTCACATGCGTATGATCTTCGAGATCCGTGATCTAGTCTACGCTACGCCGGCTACCGTATCTCGT
GCCGGCATTCTCTACATTTCAACATCAGAGGGCTACCAGTGGCGCTGCCTGATTGACAGTTGGCTTGATCGACACTGTCAGCAGCCTGTGGATCACCGCC
TCAGAAATATGATGTTCACCCCAGACACGCGCTCCAAATTCCAAGCGCTTTTTGATCAATACATCGAAACGACCCTTCGGTTCTTCCGAAAGAAACTCGT
CCCCGTGGTCCCTGTAGAAGAAACGACGCTCGTGACGAACTTATTGAACATGATCGATTGTCTGCTGACACCCCAAGTGTTGGAAGATTACACAGTGATG
CAAAACACGTTCGTGTTCTGCTGTGTGTGGTCGTTTGGATCCATCCTCACCATGAGTGACGATGGCACGGACTACTCAGTCGAGTTTAGCAACTGGTGGA
AAAACCAATGGAAGGACGTTAAGTTGGTGGCATCGGCCAGCAACACGGTGTTTGATTTCTGGCTTGACCCGGAGACTTCGAAGTTTAATTCGTGGTCCAA
GAGTCCGTACTTCTACACGGAGACGTATGTATCCCCAAGCCCAATCAACCAAATCACAGTACCCACCACCGAACTGCATCCATTGCATTTTGGCTCGAGA
ACCTTATCTCAAAGAGCGTGCCGGTTATGGTGTGCGGGCCTGCAGGTACGGGCAAGACGCAGAATATCATGGGCATGCTAAAAAAGCTCAGCAAGGACGA
GGCAACGGCTGCGTTCCGCTACTGTACGATCAATTTCAACTTCTACACCACGAGTTCCATCTTGCAGCAAACCATGTTTGGACAACTGGAGCGTAAAACC
GGTATCAATCTTGGTCCACCCGGCAAAGCACGACTCATCTACTTCATGGATGATCTTAATCTGCCAGAGGTAGACCCATATAACACACAAAGTGCTATTT
CTCTGCTGCGACAAGTGATGGAGTACAGACATTGGTTCGACCGCGTAAAACTTCAGACGCAAAACATTCTGAATACGCAAATGGTCTCCGGCATGAACCC
TACAGCAGGTTCATTCCTGGTTGACCCTCGACTCCAGCGCCACTTCTGTACATTTGCTATGGGTATGCCTGAAGCACCAAGTCTGGTGACGATCTATGAA
ACGTTCCTGGGTGGGCATCTATCAGGCTTCGTTGATGAGCTGAGTAACTCCCAGTTCTCTAACGCGCTTATCAAGGCTGCATTGAGTTTGCATGCCAGCG
TTGTGAGCACGTTCCGCAAAACAGCAGCCAATTTTCACTACGAGTTCAATGTGCGCCACTTGTCCAATGTATTCCAAGGGCTTATCGCATCAAAAAAGGA
TCGTTTTAACAGCCAGGAGAAGTTCGTTTTGCTGTGGCTGCACGAAAGTGAACGCGTATACGGCGACCGACTTGTATGCAAAGCCGACATCGAAAAATAC
AACCAGCTCGTACAGATGCAAGTGAAAAAGTCATTCGCGTCGTGCAACACAAGCCGATACTACGCTGCCGAGAACTCATGGCCCCTCATCTTTTGCCACT
TCACTAAAGATGGCGATAGCGAGTACGACCAAATTATGGGGACGAACCTGGACGATCTCAAGATGAACCTGCAAATCCAGCTGCGCGAATACAACAACAA
CGAGAACAATACGGCTATGCAGCTGGACCTGTTCGATGATGCTGTGAAGCACGTGGCTCGCATTGTTCGTATCTTACGAAACGAAAGCGGGCATGCACTA
CTGGTAGGTGTGGGAGGTAGTGGCAAGCGCTCGCTCGCACGCTTAGCCTCGCATATCTGCGGCTGTACTGTTCGTCAGATCACGATCAGTTCAAAGTACG
GCGAAAATGAATTCAAGGAAGATTTGCGCAAAATGCACATGGCGGTAGTGGAAATGCTGTCTCGTAATGAAGAAGATGGAGGTGTCGTATTCATGCTCAC
TGATTCTCAAATTACGAACGAAAAGTTCCTCATCTACTTGAACGATCTGCTGGCGTCGGGAGAAATTCCAGATCTGTTCGCGATGGAGGATATGGACAAT
ATCGTCAACTTGCTGTCTCCTGTAGCTGGTACGAAGGACCGCAAGGAAGTTGTCAAGTTCTTCCAAGCAGAAATCCGTAAGCGACTCCACTTGTGCCTAT
GTTTTTCGCCTGTGGGTGATGATTTCCGAAACCGTGCACGTAAGTTCCCCGCACTGGTGAATTGCACAGTCATTGATTGGTTCCAGCCATGGCCTAAGGA
AGCTTTACTTTCTGTCGGTCGCGAGAAACTGAAGGAGATTGGAGATCTGCTTGGGTCAGATGAGTCGCGCGCGGGTATTGAAACATTTATGCCGTTCTCA
TTTCAGTCGGTGAATCTCTGCGCCGAGCGGTTCTTCCAGGTGGAGCGCCGCCACGTGTACACAACACCCAAGTCGTACCTGGAGTTGCTTCAGCTGTACA
AAAAGATTTTGCGCAAGAAAGTGGAGGAGTACGCTGCAGCCATCGATCGATTGGAGAAAGGACTTCAAAAGCTTAAAGAAACTGGTGATACCGTGTCGAG
ACTTGAGGTGGAGCTTAAGGTTATCCTTGAGGCTGCTGAAGACAAGAAAGCTGTAGCGTCTGGTATTGCTGAGGCTGTGAACAAAGAGAAGGCCAATGTG
GAAACTGAAAGTAAAAAGGCTGGTGACGAAGCTGCAAAGTGTGCCGTTATCCAAACTGAGGTTACAGAGAAACAACGTTCAACGCAGGAGGATCTTGCAA
AAGCTGAACCTGCTGTAGAACAGGCTATGGCAGCACTTGACTCGTTGAACAAGAAGGATTTGGGCGAGTGTAAAACAATGTCGAAGCCTCCTGCTGGTGT
AGACGATGTCTTTTCAGCTACCATGGTTCTGCTGGCTGGTGTCCACCCGAACGTTCAAGTTACCAAGACTGGTAAGGTGAAGGATGTCAAATGGGACACC
GCCAAGAAGCAGCTTCTGGGTAACATCCCTGAGTACATTGACTATTTGGTGGGCTTCAAGCAGGTCGTAGACGACGGCAAGGTACCTCTCACGAACTGGA
AAGAGGTGCGCGTGTTCTTAGAGATGGAACACTTCAACTACGATACGATTCTCACAAAGAACAAGGCTGCTGCCGGTTTGTGTTCATGGGTCATCAACAT
CGTCATGTACTACGATATCGTCATCACGGTCGAGCCGAAGCGACAAGCTTTGGCCGCTGCCAACCTTGAGCTTGAGGCTGCAAATGCTCGTCTAACCGAA
GTGACCGAGCTTGTGGCTGATCTGCAGGCAAAGTTAGACAAGCTGCTGGCCGAGGCAGCTGCAGCCGAGAAGGAGAAAGAAGACGCAATTAATGCTGTTG
AGACCGGAAATCGCAAGATGAAGCTCGCAGGCACCCTGACTAATGATCTTTCAAGTGAAAACGTACGTTGGGGGATCAATGTGCTGCAACTTCAAAAGGA
GAAGGATCTACTGGTGGGCGATGTGCTGCTTGCATCTGCTTTCATCTCATACATTGGCCCGTTCACGAAGCCCTTCCGAGATGAACTCATTAACAAGCAT
TGGGTGCCTTACCTGCGCACTGCAGCCGGAGGCGAAAGCATTGCTATGTCGGAAGAAGCCAACCCACTACTCATTCTGACAAACGATGCGCAGATCGCCG
AGTGGAACACTCAGAAGCTTCCGTCAGATCGAGTGTCAACGGAAAATGGTGCTATTGTGGTGACCACAGTGTCTATGGGACGAAGACCACTTATCGTCGA
CCCGCAGTTGCAAGCTATTGCATGGATTCGTGAAATGGAAGCGCACAACAACCTTATCATTGTGCGAGTTGGTCAGAAAATGTGGATTGAGCGTCTCAAA
ACGGCAATTGGCACGGATGGTGCCTTCCTCATCGAGAACTTGGGCGAGAAGATTGACCCCATCTTGGCTCCTGTCATTCAGCGCTCAACTTCACGTCGTG
GCGCCCGGTACGAGATCCAAATCGGTGATGCTTCCGTCCCGTACAACGACAACTTCCACTTGTACCTGCACACAAAGCTGGGCAATCCCACTACCCGCCT
GAGATTCAAGCAGAATGCACCATTGTTAACTTTACTGTCACGATGCTTGGCCTTGAAGACCAGTTGCTGAACCTTGTTGTGTCCAAGGAACGCCAAGATC
TGGCCATTAAACGCGAGAAGTTGATCCAGGAACAGAATAACGGCAAGATCGAGCTCAAGAAGCTAGAGGATGATATCCTGTTCTACTTGGCAAGTGCAGA
CGATGATATCACGAACAACCAGCCGCTTATCCAGATTCTGAGCGACACAAAACACAAAGCCCAACGTACCCAGAACAATATGGAGGCTGCTAAGAAGACG
CAAGAGTCCGTGAACATTACGAGTGAAAAGTACCGCAGCATCGCCGCGCGAGGCTCGTTACTGTTCTTCCTGATGAACGACATCAGCAAGGTGCACTGCT
ACTACATCTACTCGCTGGCATCCTTCCAGCAGGTTTTCTTGTCTGGTATCTACCGCGCGCCAGCAGCGAATAATCTCATTGCTGATGGTGCAGGAGAAGG
TGAAGCTGCACCTGCAGCTGATGCTGGGGCAGCAGCCTCAACGGAAGGTGGAGACGACGGAGGGGGTGATGAAGATGCTGAGGAGACCGAATCCGCCGTC
GCAGATCTGACAGATGAAGAGATGAAGGAGCGATGCCAAGTGCTAATGGACAGTATCACCTCGTGCGTGTACAACTACGTTCGTCGCGGACTCTTCGAGC
GCAACAAGCTCACGGTAGCGACAATGTTGTGTCTGAAGATTTTGCTGAAGGACGGGTTGTTGAGCGATTCCGAAGTCGAGTATTTCCTCATTAGCAAAGC
CCACCCGGACGCAGGAAATGCTGGATCAGCCTCAGAGTGGCTCCCTGCAGCAATCTGGGCCAAATTGAAAGCACTAGAGAGCGCCAAGGTCTTCCAAGGC
CTAGGAGACGCGATCCAAAATGACCCGGACGAGTGGAGAAAGTGGTTTGCAACCGAGGATGCCGAGCGACAGAAGATCCCGGGGGACTTCATAAAGCTTA
CAGCTTTCCAGCGATTGATATTGCTGCGCGCCATGCGACCCGATCGTGTCACCAATGCTCTGCGTACATTTATCCTTGACTCGTTGGGCGAGGAGTATGT
CACTCAACCACCGTTTAATATGGAGTCTACTTACGCAGAGACGAACTCAAGTATTCCGATCTTCTTTGTACTGTTCCCCGGTGTAGATCCAACGCCATGG
GTCGAAACGCTCGGTAAAGCTAATGGCGTGAGTCTAGAGAACAACAATTTCATCAATATCTCCATGGGCCAAGGTCAAGAAGCGTACGCCGGAGACGCAT
TGAAGCGATTAAGTACTGAGGGTGGCTGGATTATTTTGCAAAACGTGCACTTGATGCAGTCATGGTTGCCGACACTGGAGCGGCAGTTGGAGGAGGTGGC
TACTGAAGGTGCACATGAACTCTTCCGATGCTTTATCTCAGCTGAACCGCCCCCGCTGCCTGACATGCTGAACATTCCTGAGTCGCTACTCCAAAGCTGT
ATTAAAGTCGCCAACGAGGCTCCCTCAGATATCCAGTCGAACCTACGACGTGCTTGGGCCAACTTTGGTGAGGACAAGGTGCAGGCCTGCACTAAACCAT
CGGAATTCAAGGCTTGTCTTTTCTCTCTGTGCTGGTTCCACGCTATCGTGCTAGGAAGGCGGCGATTTGGTCAACAAGGATGGAGTCGAGCGTACAGCTT
CAACACGGGAGACCTCACCATTTGCGCCAATATTCTTCACTCGTACCTGGACAACAATGTATCCGTTCCATGGGACGATTTGCGCTATCTCTTTGGTGAA
ATCATGTACGGTGGCCACATCACGGATGCCTGGGACCGTCGTACAAACAACACGTACCTGAAAGTGCTCATCGATCCAGGACTTATGAGCGGCATGGAGC
TCGGTCCGGGTTTCAAGTCGCCGAATCCTCAGGAGTTTTCCTTCGCAGACTATGCCAACTACATCGAGAAGAACATGGTTCCTGAAGCTCCACCACTTTT
TGGGCTTCACCCGAACGCTGAAATCGGCTACCT