Description :
From Genome Similarity Track
Location :
Scaffold_334:1605- 3437
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_334-snap-gene-0.7ATP-binding Cassette (ABC) Superfamily

Sequence
1832 bases(100 bases per row)
ATCCTCAACAATGTGTGGGGTCGATCGGCTCCAGGCGAGCTCACGGCCATCATTGGGCCCTCGGGAGCTGGCAAGTCGACGCTGCTGGACGTACTGGCGG
GCCGTGCGGGCCGCTTGTCGTCCTCCAGGACACCGGTGTCGTCTTCGTCCACTCGGCCTCGCATCGAGGGACGCATCGACGTCAACGGCCGGCCGCGCGA
CCTGCGCACGTTCCGCGCCGTCATGAGCTACGTGCCGCAGGAGGCGGCCTTCCTCGGCGCCTTCAGCGTGCTCGAGACGCTGCAGTTCGCCGCGGGTCTC
TCGCTGCCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCCCGCTGCTGACCCGCGAGATGCGTGTGCAGGATGTCATCGACGCCATGGGGCT
CCGCGCCTGTGCGCACACCCCAGTCGGCGACATCTTCCACAAGGGCATCTCCGGCGGCCAGCGTCGCCGGCTCGCCANNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNTCCGTGCTGCTGCTGGACGAGCCGACCTCGGGGCTCGACGCGAGCTCGGCGCGCCGCGTGATGGAGTACCTCGCGCGGCTGA
GCCGCGAGTCCCGCAAGAACGTCGTGTGCGCCATCCACCAGCCGAGCTCGGCCGTGTTCGCGCTGCTGGCCAACCTCGCCGTGCTCAGCCAGGGCGAGCT
CGTCTACTTTGGCCGCGCGCGCGAGGCCGTCGCGCACTTCTTCGCGTTGGGCCACCCGTGTCCCGTGTACGCCAACCCGGCCGAGTTCTTTGTGCATCTC
GTCAACGCCGACTACAGTTCGGGCGACCGCGCGATGGACGTCTCGAGCTTCGCCCATGCGCTCGAGGCCAGCGCCGCCTACCGCCGGTTCCANNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNGCCCGCGACCGCGAGCGAGCGAGACGACCTACGACTGCCACAGGCGGATGCAGCACCGATGTACTGCGGCTGCTGG
ACGACCGCGCACTGCTGCGAGCGCTGCGGCCGTCGCGGTGGACGCAGTTCGGCGTGCTGCTGCACCGCCACTGGCTCAACAACTGGCGCCACCCGGGCGT
GTTCTGGGTGCGCGTGCTCATGTACCTGATGCTGGCGCTGCTGGCTGGCTCGCTGTTCCGCGCGGCGGTGGCCCCCGCGGACGCCGACCCGCGCGCCGCG
GCGCCGCTGCTCTTCTACCTCCAGGCCTTCCTCGTCTTTATGTCGGTCGCGGCGCTGCCGGCGCTGCTCGAGCAGCGTGCCGTGTTCGAGCGCGAGGCCA
TGAACTCGTCGCTCCACGTCGGCAGCTACGTGCTCGCCAACCTGCTCGGCGCGCTGCCAGGCATCCTGCTCATCGCGCTGCTCGCCACGACCGTGGTCGT
CACGCTCGCGGGGGTCCACGCGTTCGGCCCCTTCCTGCTCAACCTCGCGCTCTCGCTCGTCGTGGCCGAGTCGTGCATGCACGTGCTCGCTGCCGCCGTG
CCGCACTACATTGTGGGCATCGCGCTTGGCGCGGGCGTGTTCGGCATGTTCATGCTCTGCGAGGGCTTCCTCGTGCCGCGGCCGGCCATGCCGCCCTACT
GGCGCTGGGCCTACTACGTCGCCTTCCACTCCTACTCGTTCGAGAGCTTCATGTACGAGCACCTCACGCGCGTGCCCAACGCCGTGGAAGCGCGCCAGGT
GCTCGCCGACTACGGCATGGAGCACGTCGACACGGCGCGCGACATGGCCGTGCTCGCCGCCTACGCCGCCGGCCTCCAGATCATCTTCGCCGCGCTGCTC
GTCGCACGCGCGCGCGCGCACCGGCACTGAGA