Description :
From Genome Similarity Track
Location :
Scaffold_1208:1605- 3270
Transcript NameFunction/comments
Phyta_totarag12406hypothetical protein PHYSODRAFT_527111
Phyta_totarag12407hypothetical protein

Sequence
1665 bases(100 bases per row)
CTACTTGGTGTAGACACTGATGCCGACGCAGTAGCTGCACGGCACGTTGCCCTCGGGGTCTGTGGGAGACGCAGCGCCACCGTCTCCACGACGTTCAGGT
GGCACTGGAGGCATTGTTTATCAAGGAGAAtaggtgcagcagcgacgcaacctctcgatTGACCACCTgagagctcaagaagacaTCCCTCAAAGCGTTC
GCACAACCTCTCACTATTGGTTGGAATCACGTGGGTAGGGCTACGTCTTTGTGACACCGCNAGAACGCAAACGAGATGAACGGTGTCGATGCGAAGAatc
tgcagctcttcctggcgaagaaggacgGCGAGTGGCTGACGGAAAACGAGGTGAAGGAAGGTGTGAGTGACACCAGTGGCCTGAAGGCGTTGGATGTTGT
GCGAGCGAGGCTACAGAGTGTCGGGTGGTCGGACGAGCAAGTGGGCGAAGTgaatgacgaagaagaatcAGCCGGAAAGGGCCCtgtgaacgtgctggtg
aaggtTGTCCAGCAAGAGCTAGTTCCAGCTGTGGCGACCGcttcgaccaagaagagaaagcTCCCTGAAATCATGGACGTTTCACTGCAAGAAGATCACA
AGACTGACCAGCGGGAGGAATTGGAGCTGTACCGACGACGAGGGCAAGTGATCCGGGAGAAGTGCCCAGGCTACTGTGAAGAAATCCTGAAGAAAATCGA
TGATCTCTACaccagtggtggtggtcCACTTCCGTTCATTTGCGTGGAAGGGTCATCAGGCATGGGGAAGTCTCAGCTCGCGTTCGCTCTACAAGGACAG
CGACCGTGGTTTTACTGGCTTGCCAGTCCAATTGGAGTCGAGTCTCAGAGGCTCTACAAATTTTTTGGTTCGGTATCCTCACGATTTCGCGCTTTCGTGA
CGAAAGATTTGACCATTTCCGGTCAAATGGTGAGAAGTGAGGCGAATATGTTGAACTCCTATTCTGGGGTTTACCGGGATGAAAGCCTGTGGACCTACGG
GTTTAttcgcgcgctgctggaatATTGCAGCTTAAAAGAACATCAATGCGCTCGAATGATACATTTCAAAGAGGAGACAACGCTCCATGTGAGCAAGTGC
GACTTGCGCACTATCCACGCTGTGTGCAGTACGATGGAGAAAGAGCAGAAGGTGTTGCCCTTTTTCATCTTGGACGAAATGACACCCAACGCGAACATCG
AGGCTGGGGGGAAGAACCGAAGTGGTGAAATACGTGACTGATCACTGGAGTGTCGAGCTGTGTACTCTGCTAGACGAAGTATTCGGCCGTGTCTTCTATA
AGACGCAAGAGGGCAAACGTTTCATGAGCAAACAAGAGGGAAAGGACGCTCAGCTAATGGCGATTTCTTTCACAAATGCCGTCAGGAGCGCCCTGCCGCT
GAAAAAGAGTAAAACGAATACAGTAGAAGGGGACCCACAGTATGCATTTGCACTTCGCAAACTTGGTGGATGATCGCCTTACGGATGTGACCTTGTCGAA
CCAGGAGCTTCGACTAGATGATGATGTGCTCTGGAAACCACTTTGCCGCTTCCCTGAAATCGAGGAGGACCTGCTGCTCTACCTCGCGATATTGGGCGGG
AAGTCGTACTCGGGCTATTATGACTATGGAGTTCAGAAAACCTTCTCAACAATAAGGATCTTCTC