Description :
From Genome Similarity Track
Location :
contig_38:160474- 185407
Transcript NameFunction/comments
g8710.t1hypothetical protein
g8711.t1RAW31866.1 Tyrosine aminotransferase [Phytophthora cactorum
g8712.t1XP_008909584.1 hypothetical protein, variant 1 [Phytophthora parasitica INRA-310
g8713.t1RAW31858.1 Dynein alpha chain, flagellar outer arm [Phytophthora cactorum

Sequence
24933 bases(100 bases per row)
TCTATTGACACCGACTCGAGGTTGGCCGTTAAAATTTATTGACCGACTTCGTTTGGCTTACCGGTATTACGGTGCCCCACATGGTACCGCGTACCACCGA
TAAAACCCATAAAAAATACACGATTACCGTAGTTTTACTCATAACGCACGATATTTACTGGTTCATCATTGTACCGTTCATGAAGCTGTGTGTCTGTTCT
GGCTCAATCATGTACACGTATTGGTCTTGCCTTCTCCCTCACGGATCACTCGCACGCCGTTTGCCGCACGCAGCTCATGATGTATCCAAATGAATGGCGA
GTACACAACGTAATATAACCGTTATATTACTGACCATTATAAACAGAGGCCAGCTGAAAAACCACAATGAGATATGATTGGATGACCGTTATAAGCAGGT
ATTCGTAATAAGCCAAGGAAGTCGGTAACCCCAGATTCAACATTTGAATGTCGGCTGAAGTGTAGTGCAGGAGCTATCCCTGTTGCCCAGTCCAGACATG
GGATGGTCTGTCCGTGCGGCTCTCTCAAGTCTAACCATTGTTGTCTAACTAAGCATTGCTGGGCGCACGCATCCTGTACGCGCTTCAATATTGCTCTCAT
GAACGCAGCCAATTCGAAGGTGTTCTCGAAAGGTGTTGTTGGGTACGCCCGAGGCTTCGCAAGCCCTCACTTTTCACTTCGTTCCGTCAAACGCACTCGT
CCAGTCTCCAAGCTCCAGCGTCGCGCAAGTGCCATCCTCCGCGGGAGGTGAGGAGGAGGGCGAGGAGGAGGAAGTAAAAGATCGCTGAAGGAGTCCCGAC
AGCCAATCCAAAAATGCTATTCTTTGCGGAACTCCCAGCGCGGACGTGAGGCTCGAGGAGAATGCTCCGTCGACTCGAGAGCTGCGCAACGGATGTCACG
TCATGTGACCTGAACGACGGGACTGAGCACCGTCCAAGTTTGCTTCAAGACAAGACATAGCAGAGTGTCGCCGTGTGCCTATCTGGAGGTGGGGAGGGTT
TGCATGGCGATAGCCGGCTCGGGCATGAGCCCTTTCGGGCTCTGTAGGCTACGTAGGTACCTATAGGACGCTCTTCAGGGATAATGGGTTAATTATCCAT
CTGGAACTGTTAACCACGGGGCTGACGCTTCATTCCGCCTGAAAGCATGGTCCTCTCGATCATAACTTCTCCATTGGAGAACGATATCGTCGAATCTTCA
GTGCTTCGAATAACCTGCACCGTGACACGGTGCCAGACACATAGCGGCTGTGCCTTGACTGAAATGCAGCAGAAGATTTCCGTTCCTGGCGGGTTTTGTA
CGTCACGAGGGTGCAGTGTACAGCAGGACCTGTCTTCTGGTCCGAGGGTTCCCTGGGTTTCAGTTCGGTTGCATTGAAGTTACTGTGTCAAAGCGATGTT
GCAGCAATCGACTTGGATATTGCTGACCTCGCCGAGCTATCCTACACGACGTCCGTCTCGCCCGCGGCCACTATCCTATATATATAATACCGAGGTTGAT
ACTTGCTGCGAGGAACGTGTGTGGGATCGGTTTTCTCGTGGGTTGCCTCGGCAGCGAGCGCTTCTCCATCCATCGTCGTGGAAGACCGCTCTCTGGAGGT
CGAGACATGGTGTGACCCCCCCAGCTGGCTGCGTTGAGACTTGCCCCAAGTCTCGATTGCAGGTGGAAATCTCTCTGCCGCATTGACCAAAATATCCTCA
TTCTTCAATTCACTTCGAAACCGGCAGTAACGACTGTGGGTGCGGTTGTCGAGACCGGTTGGTAGCTGCACATGTTTTCCTTTTGACAGTCACAGGCCAC
GTCCTGCCGTGTGCAACACGCCATTCTCACTGTGATACTTGTTGCTTTCTCTCGCTTGCTCGGTCGTTCCCATCTGTCTGCCTGCTCAGAAGAAATCTCG
CTCTTCGACGGAGAGAAGACACGAACATTGACCCATTGGCAGGTAGCGGAGTGCGGCATCTGGTGGATTTCCCTCGATCAAGTGAAGTAAGGAGGCAGAG
AGAAGCAGCGATATAAGAAGGGGGGAGGCCATGCCGGTTCAAGTGCGAAACAAGTTGCCTGGCAGAGAGCACCTGCCGGAGAAACCCATGCACCAAGACT
TCCCCGTGTTGTCCTGCAGCCTGGCAGTGAAGCCTGTCAAACGTAAACCGCTCGTGAAAAGCCGATTGGCAATGGTGGCCAACAGCGAGCGCGTCAAGAA
GCCGCGCCGCCTTCCCGGCGATGAGACCGTCTTCTACAGCAATATATGGTCGCCACCCGAGTCCACGCGGGACGTGCGTGTTTCCAAGAAGACGACGCAG
CTCGTGGACATCAGCCAGGTAGCGCACGTACTCACGACTATTGACTACAAGAGTGGCTACGAAGTCCCATCCGACACGGCGTTTTTCAATATCTGGGCGT
CCATCGAATCGATACAGAATACCAAAAACGCCGCCATGATGAGCAAGACGCAGCAGAGCGCTAGTAATATGTCGACGCCCATTTCCGAACACAGCAGCGA
GGAATGTTCATCGGTGGCCACGTCGTCTAGTCAGTTGAGTCTCGGGCCACTGAGAATGGATGCGAGCGCGCTTCGACGAGAGCTTTCAGGAGACGATTTT
ACCATGGTGATGAGTGCTCCCGTGTCCGCCCCGCAGCGCAAGGGCGAGAATGTAGTGTTTTCGACAGTGTTAACGCACAAGGATGAAGTCGACATGAGCT
GGAATTCGCAGTTCCTGCTGGGACTGCATGAACCAGTTCGGCACGCGCTTTTCGTAATCGATCGCTTCTTGGAGCGCAGCCGGAGCTTGAAGTCGCCCAT
GAACTGGAACGTGGGCGCGTTTTTCATTTGGTTCAAGATGCACTTCGTCGAGTTTGTCCGAAACCAGCACGACGTGAAAACAAAGGTGCTGCTTCCGCAC
GTGGTTATCAAGTTTGTGGAGAAGCGTGATATCGTTGCCCTGTACCAAGCTATTTTCACATTGGTGGATGTGATCGTTGAGCAGGAGGACGGATTGCTGC
TATCAGCAGTCTCGTCAGCGGATTCATGGCAAGCTCGTTTGGGTCTACTTCAGGACGATATCCGACGTCTCAACCACCTGCTTTTCAACGTGCTGGCGCT
AGAAGAAGAAGCCTTCAAGCCCGCTATCGAGCTCGCATTTTCAGAAAAGGCTTTCCAGCGGTATGTGATGCCGCGTATCTTTCGCGCGACCAAACCCAAG
CGCGTTATGGTACCATGGATTGTGGAGCGAAGTCGCGTCTGGGGTGGCACCAAGGTCGCTAAAGCGTATAAGGACGACCTGTCATTCACTGCGCGGTTCC
TATATGACCACGTGTGGCACCCGTACTTTGAAGCGAATATTGCATCTGCCATGAAACACTTGGGCAACGAAGTCGAAGGTATGGCTGCCAACGGTTTGGA
TGAGTCGTGGTTTGGATGCTCGGTCATGTAGTGAGTGACCATTAACACCGCAGGTGTGCATCCGAGAGATCATGACAATATCGGAGCAGTGCTGCTTCCA
GCAATCGACACCAACAGAAGGACCGAACGTTCTCGTTTAGTATTTAAAAGGGAGCCCCAAATAAATTGTCGTTCCCTCTCGTTCGCGTTTGATCGGTCAA
TAGTTTTCTTGCCGAGTTGCTGAGGATAACCAACCGCAAAATAGATCAAACGATGGAATTGAGGAACTCCAACACGCGCTTTGCGACCAGGAGCTGCCTC
GTTCTAAGCTTGATATCTTCCGTGCATTTGCTTTCCCCTTGCGAGCCGCGGCTTCTGCTCTCTTAGCTGCCGCAATTCCTTTTCTAGCACAGTCACGTTA
TCCTGATTGGGACTGTTGATCGCCTTGAGCAACGCGGAACACACCGCGACATTCGCCGCATATGCTGTAGTTGTCGAGAGTACAATCTTCCTCTAGCTCG
CAGCCCAACGGTTTGAGTTGCTGTTGGCTTTGCAACGCTGAGCACGGCCTCGTGGAAGCTAACGTCTCCGGGTTGCGATGTTTCCGAGCGCTTAGCCATC
ATCCACAGCAGCGTAATGCATTTCAGGTCGTAGTCGATGGCGATGGCGACTGACGCCGACTTGGACCCACCTGCACTACACGTAGTGTGCAACTCGCTCG
TATCCGAAACGGAGCATCCAGTGGCGAGCGCCCGAGTCCTCCAAGCGCAGCCATTGCGGGCTACGCAAGCGTTGGCACGTCTTGCAGTGACATCCATGAC
TGCAACGTCAACTGTCGAACATATTGGGCACTGTCGGTGTCGAATCGAACATATTGGGCACGTCGGTGTCCCGCGCAGTGCCAGCCATGCTTCAACTTGG
TGTGCATTCCACACTACTCGATGTGCGGTACACAAATCTTAAATCTGCGACAAGGTTCACACCATCCATCCCAAAACCTGCGCGTAACGAGTGCTTGGCG
CAATGAGCGAGGTGGCCGAGAATCCGCCAACCAAGCAGGAAGGAACAGCGCTGCAGCCTCCCACGGACGCGCAAGGACATCCTGTGCGCGAGTGGATTGA
CACGCTGCTGCAGGCGGCCGGAATCGCCAAGGACAAGCAAAAAACGCCTGCGCAGAGCGACGACAAGGCCGCGGTCAATCCAACAGACGCTACGGCTGCA
CCCGACGACGCTAGTGTATCTACTACTGTTGCAGATGCAAAGGATGCTGCTGCAACTGATGCGACAACGAGTGAATCGAATAAAGAGGACGAAGACAAGG
AGTCGTCACCGACGGTCTCCGATACAAAGGACGTTTCAATGGACCCTGCTGCCGATGAAGCAAAGCCCGGGGAAGGAGCTTCTGCTCCAGCGCCGAAGCG
ATACCGCCGCCGGAGATGTGAAATAGAAGGTTGCTCCAAGTTCGCGCGCTTTAACAACGCCTGCTCGGGGCATGGCGGGCGGCGTCTGTGCGCGGAGGCA
GGCTGCGAGCGCGTAGCGCAGTTTGGCCACAAGTGCAGTGCACACGGTGGCATCAAGTTTTGCAGCGTCGAGGGTTGCCAACGTGCCGTGCAGTCTCGTG
GCTGCTGCAAGACCCACGGCGGAGGTGTGCGGTGCCAGTATCCCGACTGCACGAAGGGCGCCATATCCAAGGGCTTCTGTCGATCGCACGGTGGTGGCTC
GCGCTGTGCCGAGGAAGGCTGCGAGAAGTGGGCCCAGCGCCACGGATACTGCGTGCGCCACTCGAAGTCATCGTCTGCTCCGAAGGCGACGCCTATCCAA
CGAGCACGGGAACCCTCTGGTGACTCGACCGTTCCATCGCCAGAACCACTACCGAATAGCGCTTCGACTTAGCATCCTATCCATAGCACAGCAGGAAAGC
GTCGCAATATGAAATTGAGAAAACATCATGCTGTGTGCACCACACAATGTTTGGCATCACAATGGCGCGCGACCCGGTCTGCTACGCTGGCTTCGCAGTG
CAATGCGTGGCACCAAATCAATTGCCAAGGTTCGCTCCAGAGTCCGTTCACTTGCTGGAATCCTACGCGGCACATCGAGATACTGGTGAGAGAAATGCGA
TCTTTGGGTGCTGGTTGCAATGCCAGGAGCTCTAACACAACGTGTGCAATGAATTAGTGGTGGATATCGCGTGCAAAGAGCGATCGAGTGACTGCTACTC
CGGCAATGAGAAGGCCAGACAAAGTGTAGACCTGAAGTTTGGCGACTTCGTGGACTACTACCAAGCGACGTTCAGGAAGCAGTCGCATTGGCTGCAGACG
GTGGGTGGCCTGGAGTTTTATTTGGCGCAGTGCCCCATTGCAGTGCCCAAGCCCGATGCTACGTGCACCAAGGCAAGTCTGCCAGCCATAATGAACCATT
TCCGCATGTAAGGTGGTTATTCTTGTCATCTCTTGAGCCTGCAACTCTGACGGGCTTGTTTGTGGGCTTGCTACTGCAGACCGGCATGCCTTCAAGGCAA
GTCTGTCACCCAAGTGAACCTGTGGATGACCGTGCAACCTGGCCGGACGACGCTGCACTACGACGCGTACCAAAACATCCTAGTGGTGTTGTATGGGAAG
AAGGTTGTCACGCTGTATCCTCCGTCAGACACCGCTAAGATGTACCCGTACCCAGTGCATACCAAGTCTACAAATCACAGCCAAGTGAACATTGTTCAGC
CCGACTTCGCAAAACACCCACGCTTCAAGGAGGCGTCGGCGCAGCGCTTTGAAGTCGCTGCTGGAGGTATTGCTGATTGTATTTATGAGCGGTTTACATC
CTATCCTTTTTGTTCAGCCGTTGATAACAACTAAGGCGTTGTTAACTGTCCTCTGCAGATGCCGTTTTGATCCCGGAGGGGTGGTGGCACCAGGTGGACT
CGGACGAGTTTACCGTTGCCGTCAATTACTGGTGGAATGGCGTGCGAGATCAGCTCGTAGAAGACCCACGCATGGCGCCGTATTACGGCCGGGTTATGCT
GGAGGAGCTAGTGAAGCAGCAGTGCGAGTCGCGTCTGTCAGCCGTGCGGTCTTCAGCGGCAGCAGGTACCCAGAGTACATTCCAAGACGAAAGAAGAGTG
GTGGCAGCTATTGTTGCAGCAAACTCTCAGGAAACTCGCGAGAGGATTTTTCTATCGCTGGACGCCACCACCTTCGTAAAAACTCAGCGACTCCTGGCAA
CGGATCATGCCCCATGCTGGCGGGAACTGCTTGCGAATGCTAGCGTGGACTTGGTGATGGTCTTGGCCGACTGCTGGGAGAGCGATGACTTTGAGGTGGA
TCTCCTTGGTGTGCTGTTTGGTGCTTTAGAAAGCGAGGAAGATGCGGTCAAGGAACAACTTGTGGCCAAGCAAGCGCAGTTCCGCCGAGAATGCGCTGTC
GAAATGTACCAGTCGCTATTTGGCTGAGCTTCAAGCACCTGTTCAACGTGAAGCCGTTACCCTAGGTTGAACTCGGGGCAGTCGACCAGCGAAAAGCAAC
TTGTTGAGCGGCGGCAATTGGCTGAAATTAGTCCAAATGACGTCGGTGCCCGTCAGCGCGGGTAGATAGGGCAGAGATTGCCTTTTGCGTCTCTGAGACG
CCGTCTCAACAACAAGATTAGCCTGAACAGGGATGGCTCAACCAGACTCTCATTTCTTAATTGACCGCTCAACTCAAGTGTCTTCTGTCGTCATGACCAA
GCGTGCCACCTTCGACGATCCTGCCTTTGACGTGCCGATGGTAGATGTCAAGCGTCAAGCCAAGCTCCAGTGGAATGTCCAGCCGTCCGACTTCTCCAAG
CTGTGCTCCAACCCTATTCGGAAAATCGTGGACAACATCAAGAAGCCCGCGACGTCGACCAAGACCCTCATTCCATTGTCGCTAGGTGGGTGACCCTGTT
TTGCGGGTAGTATTTATTTTTCAGAGCTAATCGGGAAACATTCGGCCGTGGCAGGTGACCCCACGGTGTTCGGCAATCTGCACTGCCCCGATGTGCTCGT
CCAGGCGATCGTACGAAACACCCGGTTCGTTGAAAGCATGACTTTCTGTCTAGCCGTTCTCGGCGCTGACCTTACTGTTTCTCTTGTTGCTTCATCAGTT
CGATGCAGCACAATGGCTACATTCATTCTGCTGGCTCCGAGGCAGCTCGCGCAGCAATTGCCCAGCACTATGGCAATATGAGAGCTCCGTTGACTATGGA
TGACATTATTATCGCCAGTGGTTGCTCGGGGGCTATCGAGATTGCTCTGCGAGGTTTGCTGAACCCTGGTGACAACATCCTTCTCCCGAAGCCAGGATTC
CCGTTGTACCAGGCTCTCTGTGAAGCGCAGAAGATAGAGTGTCGGTTCTACAACTTGAAGGTGAGCTGCTCTGTCAACTAGTATACAACGTTCCCTGTTT
GCTAGACTAACGAATTATGCGATCAATGCTTGGACAGCCGGAGAGCAACTGGGAGGTCGATCTTGAGCATCTCTCGACTCTGGTGGATGATAACACCAAG
GCCATCCTGGTGAACAACCCTTCCAATCCGTGCGGCAGTGTGTACTCGAAGGTGGGTAGTGGTGATGGTTTATTGGCGCCATTTCGTGGCCGTCGCGATT
TTGTTTTCAAGTGTCGTAGAGGGCTTCAATCTCTAACGTTCTGCATTTGCCGTGTCGTATAGCCCCACCTGGAAAAAATTCTTGCTCTTGCGGAGCTGAA
CAAGATCCCCATCATCGCGGTATGCTCGTTCCTCCATATTTCCTATTGCATTCGTGAGTCTGACTCATTCCAATTGGCAGGATGAAATCTACGGCGACAT
GGTGTTTGGCAGCAACGTATTTTTCCCCATCGCAACTTTGACGAAGACGGTGCCGGTCGTGGCCGTGGGCGGTTTGGCCAAGCAGTTCCTTATCCCCGGC
TGGAGGGTTGGTTGGGTCATGGTGCATGACCGCAACAACGTCCTGAGCGACGTGCGCACCGCCTACTTCAAGCTGTCGCAAAATATCCTTGGTGCAACCT
CGCTGGTCCAGGTAACAAAACGACATTCGTCGCATCTCATGGCTGCTTGAACGACAGCTAATATGTCCACGTCGTTTGCCTGTGCTGTCTACAGAGTACC
ATCCCTGATCTGCTGACCCCCATTCCCGGTAGTGCCGAGGAGCAGTCTCTCATGGACTTTAAACAGCGGTACTTTTCGACGCTGGAGGCTAATGCCAAAT
TCACGACCGACACCCTAAGGAAGATCCCGGGCCTGGAAGTGGTGATCCCGCAGGGCGCGATGTACGCGATGGTACGCAATATCCGCAACCGACTGCCCAC
CAATATCCTAACTGGCACCTATGCTCTGTCGTCTACAGGTGAAAGTTCAAACGGACGTGCTGACCAAGATCAAGGACGACTTTGACCTAACGCAAAAGCT
GCTGGACGAAGAGTCCGTTTTCGTGTTGCCCGGACAGGTGCGTCCCAATATCCTAATTGTAGTTGCTGGATCCTTGGCTTGGCTAACCTGTGCCTTCACT
ATCGTGCTGCCGAAAGTGCTTCGGACTGACAAACTACTTCCGCATCGTGTATTCGGCGCCGCACGAGGTGCTCGCGGACGCCTACACGCGCCTCGCCGAC
TTCTGCTGCCGCCACCAGTAGCCTGAATTTACTTTATAATAGGGTTGAATCAGGCAAACAGTATGATGTTTATTTTCGTCCAATCGGCGTTCTTGGCAAA
TCGCACGTAATTTCCCAATACTGATAACCTTTATGGACACATACTTTATTGTACATTGAATAGGACGGGTAGAGAGAGGGCTAGTAGGTCTACACTCTCA
AAATAGATTCTGTATCATAGCCACAGTCCCTCTGTATTGTTATGGGTGCACCATCTGAAAATTCTCTGTTCGGAGGGAAAGACTGTCCGCGACTAAACTG
AATTTGCTCGCTGCCCGGGGGGACGCCATGACTGGACGGAGCTTCCTGCTGCTGGCCGTGCTGGCCTTCGCCACGCTGCAGCACCTGACGGCAGCCGCGG
CCGTCGACGGTGTCATCGTTGTGCGCGGCAACAAGATGTACAATGCCAAGACGGGCGAGCGCTTCTTCATCAAAGGGGTGCGTTCGAACGGCACGAAAAG
AGGATAGGAAGGAAGCGGCCAACTAACACCAAAGAGCACAGTTCAGCATAGTAAATCCTAGTCTAATATGTGTGTGATCCTGTAGATGACGTACGAGTAC
GCCGTGAGCGATGAATACTACGACAAGTATTCGAAGGCTGCGATCTCGGAGCACCTCTCGGGGCTCAAGTACAACACGTTGCGCCTGTACAACATCAACC
CGTCGTCCTCGTACAAGGAATTCATGAACGACATGGCCGCGCTCGGCGTGTACGTGATGGTTTCTGCCTCGCCCGATAACGACGCCTACTACGGCAAGTA
CCGTTACTCGACCATCACCAAGGGTCTCAGCTGCTCCGGCAAGGTCTCGTCTGGAGATGGCGCTAAGACGGTGGATCAAACGGAGACCTGCTACCCAGCG
CTGCTGCTTGAGTACGGCAAGAAGATTATCCAGAATTTTGCGCAGTACGACAACACTCTCGGTGTCGTCGTGGCCAACGAAATCATGCAGGCGGACCTGA
CGGCCGGCTCCTGTGTGAAGGCCTACGTGGCGGATCTGAAGAACTGGATGACGGTGAACGGCAAGAAGATTCGTATCCTGCCGCTTGCCTACGCCGCTGC
TGACAGTAGCAACGATGAGGTCTCGAACGCGGACGACTACCATGTGATCAAATCCAGGGACTGCTCTGTGGAGACAAGATGACGAAGGGTATGATGACGG
AGAGTATTGATATCTACCTGATTAACGAGTACCGTTGGTGCCCGGACTCAACCTTCGCGGAGGCGTATCAGCGTTACATCGACATGGCGCAAGGCATTCC
CATCGTTGTCGCCTTCGGCGAATACGGCTGCAAGACTTCTTCGGCAGCGGCTCGCGACTGGGGAATGATTCCTTATCTGTACCAAGAGCCTTCTAAGACG
AAGGAGTTCACGGCGGTTTGGTCCGGTGGGCTGGCGTACTCGTATGGTGAAGCCAAGCTTTCGTCTGACTCGCTGTTCCCGATGTTCACTGGTACAGCTC
AGCTAGTTCATTCTTGTATACTATAGCGCACGGTGGGCTCATGTTGTGTCTGCATGTTTAGGTGGCAGCACGGACTTTTTGAGTACTCCCAGCTCCAAGT
CCACGACAGATTACACGAATCTGAAGGCCATGTTTGCCAAATACTCAGGCTATACGGATGATGCAGCATGGACCGACAGCACGAAGTGCACGTGGGCTCC
TACCCTTGAAACCAAGACGCAGTCGACCAACGAGCAGGCAACGAAGTACGGCTGGGTTGTAAGCAGCTGCTCTTCAGATCACATTAAGATCTCTAGCTCA
GACTCATGGACTTGCTCCAGTCGTGAAGGCGTGGTCTGCACGGACAGCGGTGCTACATGTGACGTGAAGCTGAGCTCTGCTGTCGGAACGACCCAGGAGG
ACATTTGCGGCACGTACGAGGTTACGAGCGGTGGTGGCACTTGCGAGAGCACGTCCGACTGCGGCGGCAACGGCCAGTGCAAGGAGTCGAACGGTACCAA
GTCGTGCAGCTGTCTGTCGTGCTACACTGGCACCGACTGCAGCGTCAAGGATATTTCCTCGTGCGCGACGCTCAGCAGCTCGGACACGGCCCCCCAAACC
ATTTTCGTGGGCGTTGGCGTGTTCTTGGGTGTCATGGCGGTTGTCTTCATCGCCCTCGGTGTCGCAGCGGCTAAGAAGAAAGCTGGTACGTGCCTTGTCG
GAAGCCCATGCTAATATCCTATCGTCAAACTAATTGTGCTCTTGCATTCACAGAAACGGACAGATTGGCACAGGCGGTGAAGGCTGGCGGCACCAACCAA
GCGACTGCTGCTGCTCTGTAGACAAGAGACGGCACTAGATCGTCCTGTATTGTGGCGGGCTCTACGAGCGCTGTGGCCTACCTACCCAATGAAACTTTTC
ATGGTTTATTTGACACCATCATCACCCATTATCTGAGCCCTTGCCAAATAACCCTCCGTTTAGGTCCAGGGCTAAATATCTCAGTGATTTAAAGCCCGCG
ACGAAAAGGGTTAAATCCGCAGCAAAAGCTCACGAGCGCCATTCGTCTAATTCGTCTAATAGCAAAGAGAGACACGAAGCACCCGCACCATGCCGCCGAA
GGGAAAGAAGACCGAAGAGGTAGATAGACCCAGTAACGTCACTGCAGGTGGGGACGCCTCCTCTCTCTAACTCTTATGCTGTCGTCCTCCCTCTCCACCC
GCAGACCACGCGCACGTACCTGGGCCGCCCCGGTAACAACGTCAAGATCGGCATTGTGGGTGTCCCCAACGTGGGCAAGAGCACCTTCTTCAACTGCCTG
TCGAAGCTGCACATCCCCGCCGAGAACTTCCCCTTCTGCACCATCGACCCCAATGACGCCGTGGTGCCGCTGCCGGACCAGCGCTTCAACTGGCTCGTGG
ACAAGTACCAGCCCGCCAGTGTCGTGCCGCCCGTCATGTCCATCACGGACATTGCCGGCCTTGTGCGCGGCGCCGCCGAGGGCGCTGGACTGGGCAATGC
TTTCCTGTCGCACATCCAGGCCGTGGACGCTATCTACCACATGGTGCGCGCCTTCGACTCGACCGAGGTGACCCACGTGGAGGGCAACGTGGACCCGGTG
CGGGACATGCAGATCATCCAGGAGGAGCTGCGTCTCAAGGACATTGAGCGCGTCAAGAAGGAGTCCCAGGGCGTCAAGAAGCTCGCGGAGCGCGGCGTCG
GCGGCAAAGAGAAGAAGGTGGAGTACGAGTCTCTGGTCAAGATCCAGGAGTGGCTCGAGTCCGGCAAGGACGTGTCCTTCGGCACGTGGAGCGCCCCGGA
AGTCGAGCTGCTCAACACTATGCAGCTGCTCACGGCCAAGCCCGTGGTCTACCTCATCAACGTGAGCAAGCGCGACTACCTGCGCAAGAGCAACAAGTAC
CTGCCCAAGATTGCCGAGTACATCAAGGAGCGTGGTGGCAACGAGCCCGTTCTCCCCATCAGTTGCGAGTTCGAGCTGGAGATGCTGGACCTCGAGGCTG
GTGGCGAGCTCGAGACGTACCAGAAGGAGAACCCGACGCACAAGTCCATCCTGAATCGTGTGCTCCGCATGGGGTACCACGCCCTCGGTTTGATCCACTT
CTTCACGGCTGGCAAGGACGAGGTGCGCGGCTGGACGATCCGCAAGGGCCGAATGGCACCCCAGGCGGCTGGAGTTATCCACACGGACTTCGAGAAAGGC
TTCATCATGGCCGAGGTGCAGGCGTTCGCTGATCTGAAAGAGCGTAAGTTTGTCTTTTCTGTTTGTGGTGCTGCGCGGTGCTGTTCAACTTTACTAACTT
TACGTTTTGGAATTGTGCAGTGGGCACGGAGGAGGCGGTCAAGAAGGCTGGCAAGCTCAAGCAGCAGGGCAAGAAGTACGAGGTCCAGGACGGCGACATT
ATTTTCTTCAAGTTCAACAACTAGGTAGGTCAACTGCTGCCGAGTGGTGTTGAGTGAGTCGAGCAACCGTGGTGCCAAGACCTCCGTTTTAGCCATGTGT
GGCCTGTGGTTTTGAGCCAAGTGGCAGGTAATGTCTTCGGGTCTAGAGCATGCGGATTGAAAAGCGCGGTTGCAGAGCATCCCGCAATGAAATAAAGCAT
GCGCTTTGAGCACACTGGTCTACCACAAGCAAGTTCACACAAGGAGCAAGTGCGCTGTGTTTGGTTTTGGTTGCAGGAATAACGACTTGGAGCTGAAGGG
GCTGCGATATCTTGGATTTGCCTTGACCCGTCGCGCCTCTTGCAACTGATCGCGTGGAGTTTTCACTCTGTGGCCTCCACTTAGCTCGGCGGATACGGCA
AAGCACACAAGCTCCAAGCCGAGGTGGTTTCGGTGTCGAGGTGAACCAAGTGGAAGGAATTCCGCCAGAGCGTCATCTAGGCAGCCCCGGAAAGGGCAGA
GCCGAAATGGTGTGTCACCTGGCCTGGTTGTTTTGTGCCTCTGCTGATTGAATCGTCTTATTGAATATGTTGTTGGATGCTTGGTGTTGACAGCCTATCG
GGTATGGATGCGAACCAGAACTAGCGTGGATTGCGCCGAAACAGAATGGAGAAATCCCTGTCAAGCGATCTGGGCACTCGTTCACCTTGAAAGGCTCGGA
GACGGAGACTTCTGTCTATATGTTTGGTGGCTGCGATCATAAATCGCCACCAGGACCGACGAACGAGCTGTACAGGCTAGACGTCACAAACGGTAGGATG
ATCTGCAGGGTTAACCTTTAGTAATCAGAGAGTAACTCGATTTTGCTGCAGGTTACACGTGGTCGAAGGTAGCAAGCTCACAGAGTGAAGACGATGTGCC
AGCGCCGCGATGGAGGCACTCAGCCATCCTATTTGAGAAGAACATCATCATCTTTGGAGGCTTCGCCGCTGAAAAGCGAATGAATGACCTCTGGCTCTTT
AACACCGAGCTGAAGGTGTGGGAGCAGAAGTATGCTCAAGGTTTTTGGGAGGGGCTACCGCAATGCCGCGGTGCACACAGTGCCACTTTGGTAGATGAAA
AGATGTACGTATTTGGTGGCTATGGCGGCAACGGCTTTGGGCGTACCGACTTCAACGACCTTCACGCGTTGAACTTGCACTCATTTAAGTGGCAAGAGAT
TCAGACTGAGGGTGAGAAGCCTGAGCCACGATCGGGCCATCAAACGTGCCTTGTGAAGGAGCAACTGCTTGTCATCGGAGGGTGGAACAGCTTCAAGCAG
TTTCAAGATATCTTCGTTTTAGACATACCAACCAAGACATGGAGCTTGCTGAGCACGTCGCTTCATTCTCCAATCTGGAATCACACGTGTGTGAGTGTCG
CCGCTGTGCCTTACTGGAAAGTGTTCTTATTTGGTGGAAACAGTGGAGATCTGGCCGAGTCTGGAACGGCGCAAGGAGCTTATTTGAACAGCACTGCTGT
GTTGGATACTGGCAGTATGGTATGGCTAAACCCGCCTGTCAAAGGAGAGCCTCCGAAGGCCCGCGCTGATACTGCGATGGTGTTTGATGCAAATACCAAT
CACTTGATCTTCTTTGGAGGATGGGCAAATCGCTGGTACAATGACTTACACGTGCTTAATGCAAGCGAGATCGTTGGGCCGCCGTACTCAGTCCTGTCGA
TCGAACCAAGGCAAGGTCCGATCACGGGAAATGCAAAGATAAAAATTTCTGGCTTCAACTTCACTGGTCAAAACGCTACACTGCGCTTCGCAGTTGCGAA
AGGCTCTGTCGACGTCACGGGAGCCGTTCTCAGTCCTAGTGTTATTCAAGCTACAGCTCCCAGCTTCGAGAAATTTGGACCGTTGACTTCCGAGGTTCGA
GTGTCGTTGTCCGGGGCATGTACACAAACGTCTCCACATCCTTCCGTTTTCACTCCGTCACAGCAGCCCCAAAGTCGCTAGCATTTGGTCCATGCTTAAT
TGCTGCCCTCAGTGATAATTGCCTGGCTGAGCTCCCGACTACATTTATCATCCAGACCAGAGATAAAGACGATAATCCGCGTGATTGTGGAGGGGATGAG
TTCACGATTGCTCTAAAGAACTGTGATGATGCCGAAGCCGAAGTGGAGCTGGTTGCATCCATCCTTGACAAAAATGACGGCACCTACGTGGTGACATTTA
CACCATCTAAGGCAGGCAAATACGAGGTCTCGGTGGATTTTACTGGCACGTTTAGTGGTGTTGCAGGCCCAATTCGCGGCTCACCGTTCACCGCGGTATT
CCAGCCGCCATCGGATGAGAATAAAACAAAGTGTTTGCCACCACTTGCAACTCAGAAGGACTTTGACTCGCCAGAGCTGATCCGGCGTGTGATGGCCACA
ATGAACAAGCGCAACGGAGAATTCCGGCGCATTCTTGTTGACTTGCGGAAAGACATCCCGAATAACGATACAGACGGCCTTGAGACTCTGCGGAAGATGA
AAGAAATTATCCGCAAGCTAGAGACAGAAAAGGCAACGAATCACTTGATTCTGGACCAAGTGCGGCAGCTATTCTTCAATATCAAGAAGAGTGGGGGGCA
TGTCGACAAGGAGCTCGTAGAAATCGAGAATATGGAGAAACTTTTTGTGGACGTCGAGAAGCAGATCCCAATGACCGAGAAGCGCACCCAGGAACCCACG
CGGATTTTCAGCGAAAAGACAGAGGAGAAGATTATCGCGTACGAGAAGATGATCGCACAAAAGGTGGAGACTCTCAAGACGCTCGATTTCTGGTCATCAA
AGTTGGAGCCTGACAAGGGTCTTGAGAAAATTGAGAGTTATCTTGTCGACTGGAACGTGGAGATGAAGAAGTGCGAAGAAAACACTAAATTGTGTTCGAC
TTTCGGGTTTCCGCAACTAATGAATGAATCGCTTCGCATGATGGGTCTGATGCGGGCAGATGCAGATGCAATGAAAACCGTATGGGCAATCATTAAGCGT
GCAAAAGTTTTTTTCCAGGCAACCCAGGACTTATTGTTCAAAGAAGTGGACGTGAATGCGCTGCAGATTGAAGTTCAGTCTGCATTGAAAGAGCTCAAAA
AGATCCCCAAGGGGATTCAGTGGAGCGATGCGTACACCTCGATTTTGAAGGAATGCCAAGCATTTGATAAGACGCATCCACTTATTCGGTGCGTGTCATC
CAGCTACATGCGACCTAGACACTGGAAGCGTATCATGGCTCACACGGGAGAGTTCCCTACACCGGACGAAGACCCAGAACAGCGGCTATCCCTGATTTTG
AGTAAGAATCTGTTCAACTTCAGTTCGGACATTAATGAGATTTGCTATGAAGCTGAGAAGGAACAGGAACTCGAGCTTAGGCTTATTGAGCTCGAGGCAC
TGTGGGCAGAGGTCAATTGGGAGATGTCTCCATACAACCCCGGTGCTGCCGAAGATGACATTGTTCCTCTCCTCAAGGTGTCTGAAGAGAACTTTGAACT
CCTGGAGACGCATCAAATCGATGTACAAGGCATGAGCGCGTCACCGTATCAATCTGAGTTTGAGCCTCGCGTCGCGAAGCTTCAGATCGGACTTTCATCC
ATCAACGAAGTGGTGCTACTGCTGGGTGACATCCAGAGGTCGTGGAGCTACTTGGAACCGTTGTTATTCAGTCTGAAGAAGTGAAAAAACAGCTACCGGA
GTTGACCTCTGACTTTGAAGATATTGATCGAGAGGTCCGACAAATTCTGAAGACAGCGTGGAAAACGCTAAATGTGCAGGAAGCGTGTACCGACCCAGGC
CTCATCAAACGATTGGAGCTTATCGTGGAAAAACTAGAGCTATGCAAGCACCGCCTGAAAGAGTTCCTGGACGGGCGCCGCCGCCAGTTCCCACGATTTT
ACTTTATGTCCGAAGCAGACTTGCTGGATATCCTGTCGAATGGATCTCACCCCGACCGGATTATGCCGCACTGCTCCAAAATCTACTTGGCGACCAAGAC
GCTCACTTTGGTAGATCGTGGCGCGGGAGAGCGGCCGGTCGCAACATCTTTCGTGGCTGGTGTTGGCCACGAAATTGTTGACTTCTTTGAGGCCCCAGTG
CTTGAGGGAGAAGCAGAAATTTATCTGGAGACTATCATGCGTGCTATGAGACTGACGTTGTTCAAGCATATTGATCGATCGCTTGTAGCTTACACGGAAA
TGCCTCGTGTAGACTGGATCAACTTTAAGGATGACACAAACAAGCCGATGGATGCAGCCCAGATCATTCTACTGGCAGCAGGAGTGCATTACGTTCAAGA
AGTGGAGCGTGCCTTCCGTAGCATTCAAGGTGGCGAGAAGGATGCCTTGAAAAACTACAACAAGATGCAGGAGCAACAGCTAGAAGACCTGATTAAGCTC
ACGCAAAGTAATATTTCGTATGCAGAGCGACAGCGAGTGATGGTACTTATTACGATGGACGCCCACGGCCGAGATATTGTAGCAAACATGATTCGTGCCG
GAGTGGAGGAGGCAACTCACTTCCAGTGGCAGTCCCAGCTAAAACACTACTTTTCACCAGCAGCGGGGAGCTTCTTGAAACGTGATAGTACATTCCGTGG
AGCAAACAATGCTCGAGCTCAGATTTTAATTTGTGATGCCGGTATTCCGTACGACTACGAATATCTTGGAAATGGTCCCCGACTGGTGATTACCCCACTG
ACCGATAGAATTTACGTGACGGCAACACAAGCACTGAACCTGCAAATGGGATGTGCCCCTGCTGGTCCAGCTGGTACGGGTAAGACGGAGACGACAAAAG
ATTTGGCTAACGCACTGGGGAAAGTGTGTTATGTGTTCAATTGTTCCCCCGAAATGGACTTTAAGAGTTTGGGAAACATTTTCAAAGGTCTTGCATCGTC
GGGTTCGTGGGGCTGCTTCGACGAGTTCAATCGTCTCGTGCCAGAAGTGTTGTCGGTGTGCTCTGTCCAATTTAAGGCTGTATGCGACGCGTGTAAAGCT
GACGACGAGAGATTTATCCTTGAGAATGACGAGGTGATGCTTGATCCAACAGTTGGTGCATTCATTACTATGAATCCAGGCTACTTAGGACGCTCTGAGC
TGCCCGAAGGTCTGAAAGCGTTGTTCCGCCCGATGACTGTCATGGTGCCCGATCTGGTGTTGATCTGTGAAAACATGCTTATGGCAGAAGGGTTCACCCA
GGCCAAGATCTTGGCATCAAAGTTTTACGGTTTGTATTCATTGCTAGGGCAACTTTTGTCCAAGCAGCTGCACTACGATTGGGGCCTTCGAGCTGTGAAG
AGTGTGCTATGCGTTGCCGGCGCATTTAAACGTGCAGAACCAGACATTCCTGAAACGGACCTGCTCATGCGCGCGCTGCGAGACTTCAACATCCCTAAAA
TCGTTGCTGAGGATATGGTTGTTTTCTTCGGTCTTCTCGGAGATCTGTTCCCGCGTGATAGTCCGAATGTGGACGTTCGGAACGACCCTCCGCGTAAGCG
TGATATGGAGCTTGAATCCATGGTACAGGGCGCTTCAGAAGCAATCGGTAATACACCTCGCCCAGAGTTTATGCTGAAGGTTGTGCAGCTGTCAGAATTG
TTGGCGATTCGGCATTGTGTCTTCGTGATGGGGCCACCAGCTTCAGGTAAAACAGAGACTTGGAAGACGCTGAAGAAGGCTCGCGAGATCATGGGCACTC
CTATGGAAGTCCAAGACCTAAACCCAAAATCGGTGAGCACGAACGAGCTTTACGGGTATATCGTGCTGAAGACACGCGAATGGAAAGATGGCTTGCTGTC
TCGAATTATGCGAGATCTGGGCTCTCGTCGCCGTGATAATGGTGATGAAGACAACAACCCCAAGTGGATTATTCTTGACGGAGATCTTGATGCTAACTGG
ATTGAGTCGATGAACTCAGTCATGGACGATAACAGAATGCTTACGTTGGCCTCGAACGAGCGTATTCCACTGAAAGTTCACATGCGTATGATCTTCGAGA
TCCGTGATCTAGTCTACGCTACGCCGGCTACCGTATCTCGTGCCGGCATTCTCTACATTTCAACATCAGAGGGCTACCAGTGGCGCTGCCTGATTGACAG
TTGGCTTGATCGACACTGTCAGCAGCCTGTGGATCACCGCCTCAGAAATATGATGTTCACCCCAGACACGCGCTCCAAATTCCAAGCGCTTTTTGATCAA
TACATCGAAACGACCCTTCGGTTCTTCCGAAAGAAACTCGTCCCCGTGGTCCCTGTAGAAGAAACGACGCTCGTGACGAACTTATTGAACATGATCGATT
GTCTGCTGACACCCCAAGTGTTGGAAGATTACACAGTGATGCAAAACACGTTCGTGTTCTGCTGTGTGTGGTCGTTTGGATCCATCCTCACCATGAGTGA
CGATGGCACGGACTACTCAGTCGAGTTTAGCAACTGGTGGAAAAACCAATGGAAGGACGTTAAGTTGGTGGCATCGGCCAGCAACACGGTATTTGATTTC
TGGCTTGACCCGGAGACTTCGAAGTTTAATTCGTGGTCCAAGAGTCCGTACTTCTACACGGAGACGTATGTATCCCCAAGCCCAATCAATCAAATCACAG
TACCCACCACCGAACAGCATCCATTGCATTTTGGCTCGAGAACCTTATCTCAAAGAGCGTGCCGGTTATGGTGTGCGGGCCTGCAGGTACGGGCAAGACG
CAGAATATCATGGGCATGCTAAAAAAGCTCAGCAAGGACGAGGCAACGGCTGCGTTCCGCTACTGTACGATCAATTTCAACTTCTACACCACGAGTTCCA
TCTTGCAGCAAACCATGTTTGGACAACTGGAGCGTAAAACTGGTATCAATCTTGGTCCACCCGGCAAAGCACGACTCATCTACTTCATGGATGATCTTAA
TCTGCCAGAGGTAGACCCATATAACACACAAAGTGCTATTTCTCTGCTGCGACAAGTGATGGAGTACAGACATTGGTTCGACCGCGTAAAACTTCAGACG
CAAAATATTCTGAATACGCAAATGGTCTCCGGCATGAACCCTACAGCAGGTTCATTCCTGGTTGACCCTCGACTCCAGCGCCACTTCTGTACATTTGCTA
TGGGTATGCCTGAAGCACCAAGTCTGGTGACGATCTATGAAACGTTCCTGGGTGGGCATCTATCAGGCTTCGTTGATGAGCTGAGTAACTCCCAGTTCTC
TAACGCGCTTATCAAGGCTGCATTGAGTTTGCATGCCAGCGTTGTGAGCACGTTCCGCAAAACAGCAGCCAATTTTCACTACGAGTTCAATGTGCGCCAC
TTGTCCAATGTATTCCAAGGGCTTATCGCATCAAAAAAGGATCGTTTTAACAGCCAGGAGAAGTTCGTTTTGCTGTGGCTGCACGAAAGTGAACGCGTAT
ACGGCGACCGACTTGTATGCAAAGCCGACATCGAAAAATACAACCAGCTCGTACAGATGCAAGTGAAAAAGTCATTCGCGTCGTGCAACACAAGCCGATA
CTACGCTGCCGAGAACTCATGGCCCCTCATCTTTTGCCACTTCACTAAAGATGGCGATAGCGAGTACGACCAAATTATGGGGACGAACCTGGACGATCTC
AAGATGAACCTGCAAATCCAGCTGCGCGAATACAACAACAACGAGAACAATACGGCTATGCAGCTGGACCTGTTCGATGATGCTGTGAAGCACGTGGCTC
GCATTGTTCGTATCTTACGAAACGAAAGCGGGCATGCACTACTGGTAGGTGTGGGAGGTAGTGGCAAGCGCTCGCTCGCACGCTTAGCCTCGCATATCTG
CGGCTGTACTGTTCGTCAGATCACGATCAGTTCAAAGTACGGCGAAAATGAATTCAAGGAAGATTTGCGCAAAATGCACATGGCGGTAGTGGAAATGCTG
TCTCGTAATGAAGAAGATGGAGGTGTCGTATTCATGCTCACTGATTCTCAAATTACGAACGAAAAGTTCCTCATCTACTTGAACGATCTGCTGGCGTCGG
GAGAAATTCCAGATCTGTTCGCGATGGAGGATATGGACAATATCGTCAACTTGCTGTCTCCTGTAGCTGGTACGAAGGACCGCAAGGAAGTTGTCAAGTT
CTTCCAAGCAGAAATCCGTAAGCGACTCCACTTGTGCCTATGTTTTTCGCCTGTGGGTGATGATTTCCGAAACCGTGCACGTAAGTTCCCCGCACTGGTG
AATTGCACAGTCATTGATTGGTTCCAGCCATGGCCTAAGGAAGCTTTACTTTCTGTCGGTCGCGAGAAACTGAAGGAGATTGGAGATCTGCTTGGGTCAG
ATGAGTCGCGCGCGGGTATTGAAACATTTATGCCGTTCTCATTTCAGTCGGTGAATCTCTGCGCCGAGCGGTTCTTCCAGGTGGAGCGCCGCCACGTGTA
CACAACACCCAAGTCGTACCTGGAGTTGCTTCAGCTGTACAAAAAGATTTTGCGCAAGAAAGTGGAGGAGTACGCTGCAGCCATCGATCGATTGGAGAAA
GGACTTCAAAAGCTTAAAGAAACTGGTGATACCGTGTCGAGACTTGAGGTGGAGCTTAAGGTTATCCTTGAGGCTGCTGAAGACAAGAAAGCTGTAGCGT
CTGGTATTGCTGAGGCTGTGAACAAAGAGAAGGCCAATGTGGAAACTGAAAGTAAAAAGGCTGGTGACGAAGCTGCAAAGTGTGCCGTTATCCAAACTGA
GGTTACAGAGAAACAACGTTCAACGCAGGAGGATCTTGCAAAAGCTGAACCTGCTGTAGAACAGGCTATGGCAGCACTTGACTCGTTGAACAAGAAGGAT
TTGGGCGAGTGTAAAACAATGTCGAAGCCTCCTGCTGGTGTAGACGATGTCTTTTCAGCTACCATGGTTCTGCTGGCTGGTGTCCACCCGAACGTTCAAG
TTACCAAGACTGGTAAGGTGAAGGATGTCAAATGGGACACCGCCAAGAAGCAGCTTCTGGGTAACATCCCTGAGTACATTGACTATTTGGTGGGCTTCAA
GCAGGTCGTAGACGACGGCAAGGTACCTCTCACGAACTGGAAAGAGGTGCGCGTGTTCTTAGAGATGGAACACTTCAACTACGATACGATTCTCACAAAG
AACAAGGCTGCTGCCGGTTTGTGTTCATGGGTCATCAACATCGTCATGTACTACGATATCGTCATCACGGTCGAGCCGAAGCGACAAGCTTTGGCCGCTG
CCAACCTTGAGCTTGAGGCTGCAAATGCTCGTCTAACCGAAGTGACCGAGCTTGTGGCTGATCTGCAGGCAAAGTTAGACAAGCTGCTGGCCGAGGCAGC
TGCAGCCGAGAAGGAGAAAGAAGACGCAATTAATGCTGTTGAGACCGGAAATCGCAAGATGAAGCTCGCAGGCACCCTGACTAATGATCTTTCAAGTGAA
AACGTACGTTGGGGGATCAATGTGCTGCAACTTCAAAAGGAGAAGGATCTACTGGTGGGCGATGTGCTGCTTGCATCTGCTTTCATCTCATACATTGGCC
CGTTCACGAAGCCCTTCCGAGATGAACTCATTAACAAGCATTGGGTGCCTTACCTGCGCACTGCAGCCGGAGGTGAAAGCATTGCTATGTCGGAAGAAGC
CAACCCACTACTCATTCTGACAAACGATGCGCAGATCGCCGAGTGGAACACTCAGAAGCTTCCGTCAGATCGAGTGTCAACGGAAAATGGTGCTATTGTG
GTGACCACAGTGTCTATGGGACGAAGACCACTTATCGTCGACCCGCAGTTGCAAGCTATTGCATGGATTCGTGAAATGGAAGCGCACAACAACCTTATCA
TTGTGCGAGTTGGTCAGAAAATGTGGATTGAGCGTCTCAAAACGGCAATTGGCACGGATGGTGCCTTCCTCATCGAGAACTTGGGCGAGAAGATTGACCC
CATCTTGGCTCCTGTCATTCAGCGCTCAACTTCACGTCGTGGCGCCCGGTACGAGATCCAAATCGGTGATGCTTCCGTCCCGTACAACGACAACTTCCAC
TTGTACCTGCACACAAAGCTGGGCAATCCCACTACCCGCCTGAGATTCAAGCAGAATGCACCATTGTTAACTTTACTGTCACGATGCTTGGCCTTGAAGA
CCAGTTGCTGAACCTTGTTGTGTCCAAGGAACGCCAAGATCTGGCCATTAAACGCGAGAAGTTGATCCAGGAACAGAATAACGGCAAGATCGAGCTCAAG
AAGCTAGAGGATGATATCCTGTTCTACTTGGCAAGTGCAGACGATGATATCACGAACAACCAGCCGCTTATCCAGATTCTGAGCGACACAAAACACAAAG
CCCAACGTACCCAGAACAATATGGAGGCTGCTAAGAAGACGCAAGAGTCCGTGAACATTACGAGTGAAAAGTACCGCAGCATCGCCGCGCGAGGCTCGTT
ACTGTTCTTCCTGATGAACGACATCAGCAAGGTGCACTGCTACTACATCTACTCGCTGGCATCCTTCCAGCAGGTTTTCTTGTCTGGTATCTACCGCGCG
CCAGCAGCGAATAATCTCATTGCTGATGGTGCAGGAGAAGGTGAAGCTGCACCTGCAGCTGATGCTGGGGCAGCAGCCTCAACGGAAGGTGGAGACGACG
GAGGGGGTGATGAAGATGCTGAGGAGACCGAATCCGCCGTCGCAGATCTGACAGATGAAGAGATGAAGGAGCGATGCCAAGTGCTAATGGACAGTATCAC
CTCGTGCGTGTACAACTACGTTCGTCGCGGACTCTTCGAGCGCAACAAGCTCACGGTAGCGACAATGTTGTGTCTGAAGATTTTGCTGAAGGACGGGTTG
TTGAGCGATTCCGAAGTCGAGTATTTCCTCATTAGCAAAGCCCACCCGGACGCAGGAAATGCTGGATCAGCCTCAGAGTGGCTCCCTGCAGCAATCTGGG
CCAAATTGAAAGCACTAGAGAGCGCCAAGGTCTTCCAAGGCCTAGGAGACGCGATCCAAAATGACCCGGACGAGTGGAGAAAGTGGTTTGCAACCGAGGA
TGCCGAGCGACAGAAGATCCCGGGGGACTTCATAAAGCTTACAGCTTTCCAGCGATTGATATTGCTGCGCGCCATGCGACCCGATCGTGTCACCAATGCT
CTGCGTACATTTATCCTTGACTCGTTGGGCGAGGAGTATGTCACTCAACCACCGTTTAATATGGAGTCTACTTACGCAGAGACGAACTCAAGTATTCCGA
TCTTCTTTGTACTGTTCCCCGGTGTAGATCCAACGCCATGGGTCGAAACGCTCGGTAAAGCTAATGGCGTGAGTCTAGAGAACAACAATTTCATCAATAT
CTCCATGGGCCAAGGTCAAGAAGCGTACGCCGGAGACGCATTGAAGCGATTAAGTACTGAGGGTGGCTGGATTATTTTGCAAAACGTGCACTTGATGCAG
TCATGGTTGCCGACACTGGAGCGGCAGTTGGAGGAGGTGGCTACTGAAGGTGCACATGAACTCTTCCGATGCTTTATCTCAGCTGAACCGCCCCCGCTGC
CTGACATGCTGAACATTCCTGAGTCGCTACTCCAAAGCTGTATTAAAGTCGCCAACGAGGCTCCCTCAGATATCCAGTCGAACCTACGACGTGCTTGGGC
CAACTTTGGTGAGGATAAGGTGCAGGCCTGCACTAAACCATCGGAATTCAAGGCTTGTCTTTTCTCTCTGTGCTGGTTCCACGCTATCGTGCTAGGAAGG
CGGCGATTTGGTCAACAAGGATGGAGTCGAGCGTACAGCTTCAACACGGGAGACCTCACCATTTGCGCCAATATTCTTCACTCGTACCTGGACAACAATG
TATCCGTTCCATGGGACGATTTGCGCTATCTCTTTGGTGAAATCATGTACGGTGGCCACATCACGGATGCCTGGGACCGTCGTACAAACAACACGTACCT
GAAAGTGCTCATCGATCCAGGACTTATGAGCGGCATGGAGCTCGGTCCGGGTTTCAAGTCGCCGAATCCTCAGGAGTTTTCCTTCGCAGACTATGCCAAC
TACATCGAGAAGAACATGGTTCCTGAAGCTCCA