Description :
From Genome Similarity Track
Location :
Scaffold_53:160468- 192768
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16065hypothetical protein
Phypa_INRA-310PPTG_16066hypothetical protein
Phypa_INRA-310PPTG_16067hypothetical protein
Phypa_INRA-310PPTG_16068hypothetical protein
Phypa_INRA-310PPTG_16069hypothetical protein
Phypa_INRA-310PPTG_16070hypothetical protein
Phypa_INRA-310PPTG_16071copper-transporting ATPase
Phypa_INRA-310PPTG_1607260S ribosomal protein L6
Phypa_INRA-310PPTG_16073Ser/Thr protein kinase
Phypa_INRA-310PPTG_16074obg family GTPase CgtA
Phypa_INRA-310PPTG_16075phospholipid-transporting ATPase
Phypa_INRA-310PPTG_16076hypothetical protein

Sequence
32300 bases(100 bases per row)
CATCGCAATCTCCGTCCCGCTGTCGTCGATAACATTGTTTCCTGAACCACCGATGTTGTAGCGTGCGATATTGAAATTGAGTGCAGGAATGTCTTTAGCT
GCACCTTCGATTGAGACGGATGACATGTTGGAGAAGAGCACGTCGGCGATATCTTCGCGGTCTCCAAAGACGTTGGCCCACCATGACAGCGATGTTCCCC
AGCCTTCCCATGATTCGAGAATTGGAGTTGTTTTGATCGAAATCCGATAGGCTATGACTTGCGAGAGTGAGTTAGCTAAGATGACCACTGCAAGTGTTGA
CGTTAAAACGGATCGACTGCTTATCATTGGCGTTCCTCCCGATGAATTCTCTGGTTCTTCTTCCGCAAAGTAAATGTGGAAATGGGAAGGAAGGAGAACT
GACCAGTACATGTACGGAAAACACAAATGCGGATGCAGCTTATACCTGGGGATCAACTGATAGCGCTCAAGATCTGCAATTAGCCGGCTTGGAAGATTTG
TATTGTAGCTCGGAGACTAATAAATGTCAGTATTGGGGTGATCATCGTCATCGAAAGTTGAATCAGCATGGATATATGATATGTTGTTATCCGTACAATC
AGGACAATTTTTTTTTTCGAATGCAGCCCTGCGTGTTTGATACGTCAACGTTGGTGGTCCGGGGAGTACTGTCCAGGTAGCGCTGGTCAAGGACGTCGGA
TAGGATCCTTTTTCGTGTTTGGATACTATGTTCATTAGACCAGCGTCGTCCACCCATAGTTAAAGGAAATACTCCTCATACTTTTGCTCATAGATGATGC
AGAATCTTCGGTCTGGGGTGCGTCGAACGCGATGCAGCGTTCCTGGGATCCGACCTTCCGTGGCTCGGTTCAAGGCGTGACCACAGAAGAGCACAATCTC
CTTACCAGGGACGCACACCTTCTCGGCCTTAAGCCACTGCTTGGAGTGTTGGTCGAACACATCCAACCCCTCCACATTAGGCACAGGTTCCACGACGAAC
AGACTCGGGTCCACATGTTCGAAAACGTTTTCCGTCTCGGATTGTCCGCTACCCTCAATGTTCGGGTAGTGCAGACCGTAGCACACAGAAAAGTCCTTGT
CGGTTCGTGAATGACTTGGCTCAATATCGTAGCCGACAGTCAAGCTCAACGCCCGGTCACAGATGCGTTGCATGCGGCGTTGAAGAGACAGCCAGTGCTT
CTTGAACTCTGGCGATGGCCACACCAGCCTCGACATATCCCCGCATGCCACGCGGAAGCAGTCGCGCACACTTGTATGCTCGTATCCAGCATACCAAAAC
GGTTTACCGTGCTCATTGAGGTAAACGTGCTTGCTGGTGCAACCGTTTTTCCAGTCCTCATCATCGCTAGTGAAGAACGCCTCGAACTCCTGTAACACCT
GGTCGTGCGTGCCCTCCAGCTTCTCACCGAGGTCTGTAAGCACCACGAACGAGTGGCGTTCCATCATTTCCAGAAATCGAGCTCGATTTTTCCAGTTGAG
TTTGCTTAGTGGTAGTCGCGGTACTTGCACGCTAACTCCCGGGACGTCGTCAATCTGCTTTACTACTATCTCACTTGGCTTCGTGGCCTCGATGACATTG
CTGTCGAGGGAAGATTCGCCACTTGCATTGAGGCGGTAGTAGCTAGCGGCCAAACTGTATCCGTTCGGCATGGGGGAAGCAGTCATCGCGGCGGTGCGGA
GGAGGATAGAGACCAAGTACTGTAATCATGTTTAGTGGGTTTAGTGTCACCGTATGAAGGCCACACGTTTTGCGTGGTTTCAGCCAATCAAATCACGATA
ATGGAATAGTGCAAGTTTGAGACCATCACTCTGCAATTCAATAATGGCAAATTGTCTTTGGCCACTGCAAGGCAAAATGGTGTTGAGTGCGTACAATTTA
CTAGTTATTCTATTGTATAAGTTATCGTGGCACTTGCGTTGATGACACGAAAACCTGCACCTGAAGAATCCGGACACCAACAAGAGTCTAGCCTCGGGGA
TAGGTCGAAGTTGAGTGTCTTCGCGATATCGTTGACTCTGTCTTGGCTGAATGCGACTGATTGTTCTGCTTGCAGGCGAACACTTGTGTGTGGATCTGGT
CAAGACCCTTCTGCCACTCCGGGGTACGTGGCTTGCTATATCTGCGCTTACTCTTGGCGGTGGCAAGAGCTCGATTGCGCTCTTCCAGTCGGCGACGACG
CTCCACATTCATGGCCCTCATGGCTGCAAAACGTGGAGAACTCTCGTAGTCCATGTACCGAGCAACAGGCGATGAGTTCGAGTGGCTCTTTGCGCGATGG
GGTGGAACCACAGGTGGTGTACTGCATGCTACCTCGGTGGTCGGAGGAACTTTCGCGGCCGAGAATGAAGAGCAACGAGACCTTGGTGCTACTGAGGCCG
GTTTCTTGGAGGTATAGAGCGAAGAGCGGCGCGCTTTTGGGGCGGGGATTGACGACTCGTTCGTCGTGATCAACGGGGTTTCTTTCAGTGTAGCGCGTTG
GTGGTGCACCTCCGTCACTTGCAAGTTCTCTGGGAATGAAGTACGTCTCGAGCGATAGACCGTCGGTTTGACATTCTTGTTGAAGTCTGGACTGGCCCTG
CCTGACGCCTGCAGTAGCTCAGGTACGAACATGTCCAACGAGCTCAATAGCGAGTCCAGCGAGCTTGTGGAAGCAGTGGAATATGTCGACGGGCTGCGGG
GTACGCCCGAGTAGCGCGTAGATTTGAATGAAGTGGTCGATTCCGCGACACTCTCGTCTTCGTACGAGTTGAAAGCCGTGTCGTCATCTTCGTTGTCCGA
CTGCAAGGTGTTGACCATGAGGCTTTTGTAGACAACAGGCTTCGTAGGAGCGATATCCTGTTCTTTCTCCGTCGGCTCCTCAGCGAGCTCCTCGAACATC
ATTTGCAAAAACTCCGAATGCGTGGGAGTATGCTGTGCGTCTAAACGATTGATAATCTCCTTCACAAGCGAGTTGTCGATCTTAAGCCTCGTCATGGGCC
CAATGTGCGGGATCCCGGATTTGGCGTTGGTTTGAGCCATGAGCTCAAATTGGTCGATGCGTGCCTGTACACTCGTGGTGCAGTTCATTATGATTAGAGT
TTCTCTCTCTCACACAAAGACTTCAAAATGTTTCTCGCAATGCTGGACTAGGATCTCGTCAGCTGGAGCCCTATCGGGTGGAAACGTGAATGGCGAACAC
ATCGCCTTACGGCGGTCAACTCGACTGGCATGTTTACAGCGCCGTTTCAGTGCGCTGGGCTGGCTTTTCCGGTCCCTTTCTGGCGCTTCCTGAACTTCCT
GGACACCATAATCAGTGCAGCCATGTAAAACCCCAATTCAATGATCTCGTTTCGAGTTTTAGCCAATGGAAGAGATTGTTTATCTTTTCTAACCAATCCA
CGGGGTCAATATTTGAAATCCAAAGCGCGGCGAAAGATCGCGCCCAGTGACAGATGGTGCGACAAAAATTCGATTTTCGGCCAATTCCACTGGTTGGTGA
TCACTTCAATGTCAACTCAATGTCCACTCTTCATTTTGTCAACGTTTCCGCCTTGGACGAGAACTTCTTTGAAATGATGCGCATGACTTCGATCGTTGCA
GCTGCGGCTGCACAGCGTCCACAACCAGTGGACCACGCCCTAAGACAGGTAGTCAGGGCCTCATCCAGGTCGCTGTCTACTACACTCACTAGACGTCGGA
ACTCGGCGCCGCCGACGTTTTTTTGCGGCGTTCTCGCTCCTTACCCATTTGCTCCTGTACAAATCGGCCAAAGGATTCCGCCAAGTTGTCAATGCGCTTC
TCGTGCTCGTGGTTCAACGCTGATAGCTCCCGCTCCAATCGCAGCACTTGACCCTCTAGAGATGCGATCAACGCTGCCTTCTCCTTCATGATAGCGGCGC
TCTCCTCGGCCGCGATCTTTGCGCTAGAAGTCAGAATCTAGAAATAGTCGATCAAAAACAATAATCCACATGAATACGAGGCCAAACGGGAAGCTACGAC
TGTTAGTGGACGCACCTGGATCCGTTCGTCGAAGTTTGCCTGCATCTGCACAAGTCGGGCGTCCTGCTCCTCCATCTTGCGCAGCTGGAGTCGCAGCTTC
TCCTCGATGCGAGATCGTTCACTCACCGCTGCAGCCAGCAGCGTCTGCTCCTCCTGCAGTGTCTTGGCCTGCGTCTCCATCGCCGTCTCCATCTCACGCT
GCTGTTCATCCTTCGCCTGCAGTAGTGATATATTGTCCTGACGCAGTTGGATGATGGTTTCGAGGTGTTTTTCCACCTCTCGCTCAAGCTGTTGCCGAGC
CTTCTTCACCTCCGCTACTTGAGCTTCGACCGATCCGACAGAGCGCTGGATTCGTTCCTGCATCTCTGCTTCCCAGTGCTGCTTCAAGTCACCAATTGAC
TTCTCGTGATCAATCTGAGACTGCAGCATCTTGGCTTGCAAGGCTTCGCACTTATCCTTGAGCTCTCGAACACTCCGCTCACTCGCTTCAAGTTGTGCTG
AAGTGTAGCTGAGCTGCGTCTGTATGGATCCAGTAACCATATCATGCTGCCGTTGAGCCGCGCTCAATTTGCCTTCGTGGTCCGACACCAGCTTCGCTTC
TTTGCGGCTGTATTCTTGTTGAGTATCTTGAAGCTGTTTATGTAGCTTCCCTATTTCTTCCTCTTGTGCTCTGCCCAGTACGTCAAGAGTTAAGGTTCCT
TAACTGGATCGACTAGTATGAACTTACCTTATCGTGAGGGACGTACGATGCATCTCGTTATCTAGTGTATATTTGACCTCTTCAAGCTGAGAAATCTGCT
TGTCTTTCTGCTCTGCTTCCTTGGAGCGCAGGGCCTCCATGTGCCCCATCTTATCTCGGATGACTGCATTCTCGCGCTCGAGTGCTGTTCGTGCTGACCG
GTATTCTTCAAACTCGAGCTTTCGCCGATTCTCAAGTTCGTCCAGCTGCATCCTCAGCTCATGGGCATCACGCTTTGCGTCGATCTCACGTTGTTGATAG
CGATCTCGCTCTTCTTTTGCCATCTCAGTATCTTTGCGAACTTGTTGCAGCTGTAGCTCAAGCTCTTCGGTTTTCTCTATCTAGTAGAAGCTCAAAGCAC
ATATGAGACCACTGCGACTACAGGCAAGGTAGTATACGCTTCGTACCTTACCATTTTCTGTCGTTCTCGCTTGCCTAGACTCACCGCTGTCTCCAGCTCC
TCCTTCTCCGCAAGGACTTGGAGTAGTAGCTGGTCATCCGGAGCAGCTTTCGGGCTCTCTTTGTTCGCCCCGCCATTTTGGCAAGATACGTCGACTGCCA
GAGGCGGTGGTCTCTCCGTGAAGGCACGATTCCTAGCCAGTAATACCTCGATCTCGTCCACATGCTTCAAGCTGCTATTGTTGCCCATAAGCTCCAGTGT
CACAAGCGCGTAATTGCTCTGCAACGCTTCCCGAAATGCCAACACACCAGGATTCCCAATCTCATTCCAACGCAAGTCCAATTGACGCAGCGTACGATTG
ACTCGGAGAGCTTTTGCGAGTGCTTTGGCACCCTCCGGTCCAATGTTATTGTTACGCAAGTCGAGTATTAGCAACCGGTTATCCACTTCCAGCGCCCCAG
CGAGAGCTTCCACGCCTTGATCCAGCAGACCGACATTGTTCCATTCCAAACTGATGGCGACCACGTTGTGTGAAGAACGCAACAGTGTCGCAAGTGCTCG
TGCTGCCCCAGCTTCAAAGCAATTGCCGCGTAGATCTAATCGTGTCGGGACGCTCGCGCGTCGGGCCTTCTCGATGATCTCCCCGAACTTGTCGTCGCCG
AGGTACGAATTACTGTAGTCCAACACTGTATTAGCAGGGTTTACGAGAGAGGAGACGAGTTTGGGGTGCACAAGAGCTGCAGCCTCCGCGTTTTCATCGA
GATACTCTCGCTTCGGTGAGATCGCCATCGGCGTCGGGGCAAGAATACACACCGATCTTTAGAAGTCAGTTGCGCCCATTCAATTAGATCGGGCCCTTCA
ACAGATATTTGTTTCAGACAGCCCAGCAGCTAGATGCACGGTAGAAACTCGCCGCAAATGTATTCATGTCTTTTGGAGCTGCCCAGGAATCTATATGACT
CATGTTCTTGTTGTAGAAGCTGCGGTGTTGGCGAGTATGCGCTGACCAACGACACTGAACGTCACATTGCGCTTACGAGAATGACTTGACCACCACCATC
AATAGACAGGTCTAACAACTGGCAAAATGCACCAGAAGCGCGCTCAACCCTCCACAGCCGATGCCAGGAATGCTGACGGACCCAACACAACATTGTGTGG
TGGTCAACAAGGATCTGGCTATTAGAGTTAAAGGGGTCCGGCTGTCAGAATCGATGTTATTTAGGGGGAGTTCTTGAGTTGTAGTTACTAGCACGCGAAT
GAATTTGCTGGGACGGGCCCAAATGTGCAATCCGCACGCCATTATAATTCGTGCAGGCACCGCGCAAATTATAGGCAAGTAAACTTGGTGAGCAGGAAAA
TGGGATGTCGCGCCACATCCAGCTCTGACGTGCCCCGTGTGAAGCGCGGCTCATTCTCACCACCGTATATGGTTGCAGTTTCAACCGTATTAAGACCTTT
ACCGTAGCATTTTATGGGGAGAGAGTGTTCCCAACATGTGCATTCGGCAGCCATACAGCTGGTTGCCAAACCTCTGCAAACATACAAGTCCAAACTACTG
CCGTTCGTTACTACAACGCAGAGAATCCACGTGTGCGGGTACATATAAGAGATCATCCAGCCGTCTAATCTGCCTCACTTCTCAAAACTCGTGGAGGTGG
CAAAGTCTCGTAACTTATATCCTGATCTCAATGAACCCTGTCAGTGAAGCTCCTTTAAGGCTGCTCTCGCGTATACAGGATAATATCGATGATCTTCAAT
GTGTGGATCTGGTAGAGTGCTCTGCTTCCGGTCGACGTTTCATCGACAAGCATACACTCATGACTTCATGTACCCCTGAAGGTTGCAATGCAAGTGCCAC
TGCGTTACATGAATTGGACCTCCACCTCTCGATTCGGGATACCGAGAACGTCGTCAAGATAGAGCGTCATTCACTGCAAGGGGAGAGACTCCACCTTTTG
CATGAACATTGTGGTCGTGGTGACCTGCTTGAGATCATGCAACAAGAGATTAGACTTCAAACCGCGGGTGTGTCACCTCAAAGCTCTTCGATGATGACAT
TAACTGATGCTGGCAGACGTCGTGTCTTCACCTCAATACTACGAGGCGTTCACGCACTGCACACTGCCGGAATCGCTCACATGGACTTGTCGCCAGAAAA
TATTTTCGTCACGAATGCCGGCGTCGTAAAGGTGGGTGATCTGGGCCACGCTCGTCGATTCAACCGCAATCAACCAAGCATTCAGGTCCTACAAGTTGCC
AAGGAGGCCTATGCTGCGCCAGAGCTGCTATGTCATACTGAGGTTGAAGATGCGCGTTGTGCCGATGCCTGGTCGCTCGGCGTCATTCTGTGGACTCTGT
GCACTAAGCGTGCCTTGGTTCACCGCGCTCCGTCTTCAACTGACGGTGATAAGCTCTTCTCTCAAATGGCTGAACGCGGCACAGTTGTCGCTCTTCAGGA
GACTGGGCTCCTATCGCATGTATCAGCTTCTTGTGTCGATCTCATTGCTGGGCTTCTTGATATGAACACTAAAACGAGATTCTCAGTGGCGACAGCGTTG
CATCACCCGTGGATAATGCAGGAGATCGCGACAACTAAGCAGCAATCTCGACGGAAGTCTATCGGCAGTATGATCAAGAAAAAGGGAGAGGAGTTCATAA
TGAAACACCAGCGTCCGACCGAAAAGAAGACCCGAGTACGCACCGCCAGTGCAGAAATTGCACTTGAATCGACACGTGTCACCTTGACATCTCGAAGTCT
AGAAGCCTAAAAAAGCATATCAAGCAAGAGACGCTTAAAAACATTCGTAGAGTGTACAAGCACTAGTAGATATATTATATCGGGATTATCCATATTAATA
CCCGAGATTTTTTTAACTCGCATAAATTAACGAAATACGTTGTTGGCACCCGAAAAAAAAAACCGTTATCTAGTTCGTTTCCTCTAAAAGAAAAACATGA
AACCAACACCTTTGCCATCACTCGCTCCAACCGTCGCTCCGCTTCATCAAGTACACTTCCTTTGATTCAGTTTCCCAAGACACGGTTTGGATCTATGCGT
CGGCATTTCCTCTTCGCCGAGGACGAGGAGGAACGCAGTGTCGGTGTAGGTAAAGAAAACCTGCTTCGATTATGGTTTAATCGCCGAAATGCTATGCTGG
AAGGCGACGAATCTGCCACTGAAGGTGAAGCGAACGCGTTGGTAGCACGAGAATTGACACAACTCTGGGATTTGGCCAAGCCTATGGATTCCTGTACTTT
AAATCGCGAGGGATACGTCGGATTATTCGCACGAGCTGCGAAAGCAATTGTACTTCCATTATCAACTGATGCACTTGCAATTGCTGCAGCACAACGAGAC
TGGGAATACGATTTGGAAGGTGTCGGAGGTATCGGTGAATCCTCGAAAACGTCACCAATCGACAACGAAGTTATGTCACCTGAACAATTCCGCGAGGCTG
TTATGCAGCTCGCAGAAATTATTCTACCCGTTGAAAGTCCCGTCGGGGTGTTTGCAAATTTCTTTAAGGAACTACGGAACTCTATCGCGGAACTTGTCGT
GTCCTACTCTACTAGCGAACCGGAGCAAGATGAGACCAAATTGGTTGAGCCAGTCGATCGCTTCACGTTGAGACCATTGAATCGGATCTCGAAAATTGCG
AACGAGTTTCTGCAAAAGCTACCGCCTTCAAGTGATACGTTGCGAAATATTCGAGGGCTGCAACCTCCGGATCAACGAGAAATGTCGCTCAAACAACTCC
TTGTGTGCTATAACCCACGTAAATTTTCGCTCACTCGTGCTTTTATTAAGAAGACCAACGTTGGTGTTAATGGGAATGTTGCCGATGCAGCTGAGACAGC
TAAGACGGATGTAGCAGATATGTCCCCACCCCATGATATGGAAATTGCACGACGATTACATGAGGAGCTTGTGGGGTATATAGGCTCAGGAGCAACTCCT
GTTCGGAATAATAAACTTCACCGTGAGTCTGCAGCGCACTGGGATTCTGAAGATGCACTCATTGCCGCTCTTACCGAGTTTCCTGCGCTGAGATTTGCTG
TTGTTGGCCCACCTGGAAGTGGCAAAACTCGACTAGCCCGTGTACTAGCACGAAAACTTGAATTGAAGTATCTGTCACTTGATGGAGCTGTGCAACGTGC
TGTCGATCATAAGCTTCGCTCGCGTCGGCGCCGAACACCTATTGCTATGCCTGCAGAAGACGACTCAAATGTCGAAACTGTTCCACCAGAGACAACAGAA
GGAGGCGAGAAAGTTGAGATTGACAACGCCGACGGAGATCAAGAAATGGATCAGATTTTCACAGATGAAGACCTTGATGCACTTTGTGCCGGACGAACAG
TACCTCGAAGCACAGCACTTGCTGTACTACGAATAGAAGCCACGCGTTTGTTGCTCGGTACGTTTGTACGTCATCGCTGGTATAGATAGCGATACTTTTA
ACGCGCTTGTGGTTTGTTTCTTGTAGCCGGCGTTGGGGTGGTGATGGATGACATATATCCGGACGAACTGTCAACTTCAGACAACCAAGATCGCAGCATA
GCAGTAGACTATTTGGTGGCACTCACAGCGTTACCCAGTGAACTGGAATACCAGCTCAAAGGCTCTGAGTTGGCTCCTGTAGCTGGTCGTTTGTACTCAG
TCCGGGAGCTTGCCACTCTGAGAACGACAAGTAGCGAGGATTTGGCTGCCAAAGGCTTTGCAGATTCTCTCTTGCCTCCGAAGACACTGGAAGCAGAAGC
AGAGAAGTTGCAAGAACCTATTGTAGTTACTAAAAATATTGAGGCTGATCCGAACAGTGAAGATCAGGACGTCGAGGCTTCTCCAGAGGAAATCGAAGAC
AGCGGCCTTGTTCCACCATACGAACCTGATCTGCCACCGGAACCAACTGCTGCAGAACGCAATGAGATTGATACACCGAATGAGCCCACCTTACCATTCG
GTTCATTTAGTGCACTAAAATGTATCAAGAAATATCATGGGTACGTGATACGTATGCAGCGCGAACTCGCGATGCGCCGAGCTGGTAACCAGTCGAACTG
TCATTTGGTGGTGGTGTTGGCAACTCAATCTCTCAACGTAATCCGAGACCACTGCATCCAGGCGATCACGGGGGTATGTAGTTTCCTAGTACTTGAGCAA
TTTTTATACTTACTTTTATGTTCAACTTGCTAGACTTTGCTTGGTTTGTCGCGGTTCAGCATCCCACGAGAAGCTTGTCCAATATCCCTGCCTGACGATC
TGACCGGTTCTAGCCGAAGTGAAAAACTGAAGTGGCTGTTGTATGGAGACTGGAGTACACTTCTTGAAGCCGAATCAAGCGAGTCATTTGCACGGCTGCC
TAGACGTGACGCAAAACGCAGACTGCTATCAAAGTGGCGTGAGTTTTGTCCCGTTCTGTCGACTTCTACCAACACTCTGCGGCTAGGCGAGCCAGAGTTT
GCTGCATGTTACTCTGGTCGAGTCTATTTTTTCTCATCACAACACACACGACGCGATTTCTGTGCACATCCACTGCAGTATTTGCGCCGAGATATACCAG
TTGCATCCGCGCATCGAAAGTTTTGGCTCGTCACGACCGGCGCTAGCGAAATCATGACACCTTCATACCTCGAGACACTAGAGACTGGACTCCAAGTGCA
GACTGTGTCTCCTTCGAAATTGGTCAAGACTTCATCCATTTCCTTGGAAATGCGACTTATGAGTGGACAAATTGTCTCCTCTGTTGAAGCTGCAACAGCA
GCCGCTGAAGCTGTCAAGGCATTGCTAGCCAAATCTAACACGACAACAGGGTGGATGATCGCAGATCTGCCTCTCATTCGGAGCGTCGCTGCTGTTCTAC
TGGAACATGGATGTGTACCCGACGTAATTTTGTTGTTGGACAGAGAAATCGCTGCTCAAGAGGAAGAAGTTAAAAGTACCGACGCTCTTGATGCTTTATC
AGTACTTCGACGTCAGCAATTTGAGGCTGAGAAATCTAGTGCTGACGATATCTCACAAGGTCTTGGTAGTGTGCCTCGCGTCATTACATGTCCGTTGTTC
AGCCAACCTTGTGACACGTTAGCAGCAATCGATCGTGAACTAAACCCAATTGCACCACGCTTGGATAGTATCGAAGATGGCCATGCTCCACAGCTCGTTG
ACGAGTACGATCCAACCGTGATATTTGCCCCACCAGTTCCCCAAAAGGATGAAGAAAAACAAGAAAAGAAATTGTCACAAGACGGAGAGACACCAAATCC
TGAGGCCGAAATGCAAGCCGGAGCAGCACGGAATAGAGCGCTTCAGCTTCAGGGAGAGTGTGGACGATTCTGTCCTGTGTCATGGCGTACACGCGGCCTG
TTGATACCTGGTTTGCCATCTCATGTTCGTTCATTTCGACAGAAATTCTACGCATTTGCTGGTGAATCTGAGCGCCGCGCTTTCGAGCGAAACCCAAGCG
CTTTCATTCCAGATAGCTCCTGTGCAACTGCGAACTTCGTGCCTTGTGTGCTGCTACTTGGTGTTCGAGGCTCCGGGCGTGGTGGAATCGCTGCAGCACT
ATCTCAACCACAAATGGAAGACATCAATTCCTCTGCACAGTACGTCAATGTCGACTTGACTGCAGTTGCAAGAATTGCTGAACGCAACCAACAGCTACAA
GATCTCAAACCGGAAGAATCACGCTTGACGGTCGAAGAAATCTTTGTCCAAGCGCTCCAACCGGAGCTTCAACGACACCAGCTAAACCGTGATAAACCAG
TAGCACAAGTTATCGCCGGACTGGGACCAGAAGATTCACGCATTCCAAACGCTGCAACTTTAGAGGTGTGTTTCAAGAACGGTCTCTTTCCAGCCCTTGT
TCTTCCTTTGACGGTATCGGAGGAGGATGCTGTCAACAATTTGTTGACGCGATGGGCTGCCAATCTGCCGGCACCTCGTCGAAAGCTTGCTATTAGCCGA
AAAAAGGAGGTAAATGGCGAAGCTGACGACGATGTCGCCCCTCCAGAAGAAGCTGAAGAAGAAGAACCGATCAACTTGGAAGCCGCGCGAGAAGAAGAAA
GCACTCGATTGCACGAACAATTCACTGAAGACCAGAAATCGTTGGACGAGGCTATCGCTGGACTTCGAGCTCGAGGTGTCAGAGTATGCGATCCGGTGGA
TGCGACCAGTGCACCAAGACAAGTGGTCAAACATGTGAGACGGATTCTTGATGAGTTCATGGTTGGACGAGAGTCACTATTTGAGCGCTGCGAAGTTCTG
GACATGACGGCGGGAGGCAAAATGTATCAGATGTTAGCGTCAGGAGAACTTCTTGTCGGTAAGCACGGCATTGCTTGTCCTGTTACTGGACGTACGGATT
CATTATCGACCACCACGATGAAAGCGATTGTGTATCGAGACCAGCTTTACTTCCCGAGATCACGTGAAGCCCGTCGTGCTTTTATGGCTTGTCCGTCAAG
ATACTTGGATAAAATCAGTCTTCCACCAAGACATCAGTCGACTTGTTGTGTGGTTGGTCCTCCATATTCAGGCAAGACTCGAGTGGCGCAAGAACTCTCC
AACGCACTCGGATTGATCTACGTGTCTCCCCAAAGTGCAGTAGATTGGGTGATTCAGTGTCAGGGCGGTTCCACGCTACGGGGTCGTTTACTGGAAATCA
CAGAGCAGCAACGTGATCCTCTAACCAACCGTGACATCATTCATGAAGTTATCTGCACTCGTCTACGCTCCTCCGAGTGTCAAACTCGTGGTTGGATTCT
TGACGGATATATGTTAAACCACCATGAACTGCAATGCAGTCTTCTGATTTCCAACGAGACAGAGAGCATTCAGCCAGACATGCTCTTCGTTCTTGAACGT
AGCTTCACTAGTGTCTGGCATGATCAACACACCAACGTGGAGCGGAGCGATCTTCGAACTGCATTTGCACGATGGCATCATTACCGTCTGGAGCTCATTG
ACGTCTGGATTCGACGCTTTGGTGTCTTCCACTTACGTCAACTTGACGGCTCAAGCACCTCGCTCTGGCACGTAGCTGCGCAGGTTCAAGCATTTCTCAC
CGAGCAGCAGCAGTTGGCATCGCATCACACCATAGCAATGGTTTGCAACCGAGCTGCTCGCTCTTTAGGTGTCGTACGTACTCGTGAAGAGCTTCGATCG
CGTCAGCACCCTATCTTCCGGACATTCTGTCCTGTAGAGCTGCATGCCGGGAGATTTTACCATTCGCGTCAATCCAATCGTGACTTGTGCGTAGATTTCC
GCGGCTTCAGTTTCTGGCTCGGAGATGAACAAAATATGCAACAATTCGTGGCGAGTCCTGAGGCTTTTGTCGGATACTTAGCAGACCAAACACCAGACGA
ATCATGGACGACACAAGAAGAAGCCGAGAGTGAAGCACAGACACTTGTGGCTAGAGCTCCAGTAAACGCTTCACTCTTGAGCTTGCTGACAGTGCCAGAC
TGCGATTTTCCGGAGTTGAAAGGCTACTGCCCGGTCACATTTGCGTCGGGATCAGGGGCCAAGGACTGGGCTGCACTGCGCCATGGAGACGTCTTCTTCC
GCGCGTCGTACCGCTCTAAGGTCTATTGCTTCGTCTCGGAGGAAGCACGACGTAAATTCTGCGCTGAACCATCTCGATATACGTCACAGAGCTTGCCAGT
CAAGTTGCCACCCCAGGTGAAACTAGCCAAGAGCTATCCTGGCCAATTAGAGCAGCAGCTTGGAGCTGCCCTTAACGAAGTTCTGCTTGCACTGGGTAGT
GAACGTCCTAAATTCCCACAGATGTCGATACGTGCTTCGGCTTGTGCGTATCTTGCACTCTCGCTCAAGGCCTTGCAGCGACGCTATCAATTGAAGATGA
AGCCTGACCCACGGTCGGCACGCGATGAAGACGAACCTGATGAGGAGCAGAAGAAAAGACAGCAACGACGAGAAGAGCAGGCGGAACAAGAGGCGATTGC
AAAGCGAGATGCCTTCGTGAGCGACTGCCGACTTGGAGAAAAGCTCAAGGCACTCGCCACTCCTGCACATCCATCCTGTGGCTCGGGCGCTAAGGTTGCA
CGCAACATGCGCGCTGCACAGGACTCACAAGCCGGCAACAAAGCAGAGAGCACTCAACCTGCACTAGCCAACGAAGACATCGAGGTGCTTCGTCATCGAC
TCGATGTTATTGTCTCCGGCACTAGTGACGACAAACCACTGTCAGTAGACCCACACACGGTACGCATGCACGCCAGAGCAGCGTTCCTCGAGTACACAAA
GGCTTCTACTTCTAGCTAGGAGCACAACAAAGTGAGCAATAAACAAACGTTGATTCTCAACAGGATATTCTACCTTGATCTCCGTCCTTTAGTTATGTTT
CTGCAGCAGAGGCGTCGACTCCGTCACGTCGATAGCTACTTGATGCTGTTGTAGTCCCCAGTCACCACCGAATGGCGGCTTCCAAAGGTTAAGTAGCAGT
GAGAAGAGAATCACCGGCACGGACGATAGCAGTTCCGACAGGCCAGCGAGGGCTGGAGGGATCCAAATCCCGAGCGGAGCATACAACGCACCACACGCGA
TGGGCATCATCAGTAGATTGTACATGAACCCCCACGCAAAGTTGTGCTTGATCCGTCGGTTGGTAGCACTCGAAAGCGCTCGGGCATTGAGTAGATCACG
CAGATCGTCCTTAACCAGCACAACGTCGGCAGCGTCGAGCGCCACGTCAGTTCCAGCTCCAAGTGCGACACCGACATCGGCCGTTGCCAGCGCTGGCGCG
TCGTTCACACCGTCTCCAATAAATGCAACGCGCAGACCCAGACTCTGTAACAAGCGCACCTTGTCCACCTTCTGATGAGGCAGACTTTCAGCCAGCACAG
AGCCTTCAGGCACGCCCAGTGCCGCTGCCACACTCATAGCTATACCGCGCTGATCTCCAGTAACAATCCATGGCTGAACTCCATCGCGCTTTAACTGCTC
AATGACACGCTTCGCTTCCGGACGCGATGTATCGCGCAACGCTATTGCAGCTACCAATTCTCCATCAATGACAACGAACACCACAATGCTGCCTTGAGCC
TGGAAACGTGGTTTGCTTCGACAAACCCGGGAGGAATTCGGAGAGAGTGACAGTCACCGTATGTCTGCTGTTTAAGCCAGGTGAGAGAACCAAGACGCAC
GTCAACACCGCGCACTGTGCAGTGGACACCACACCCTGGAACGGCCTCGAATCCTTGTGCTTCTTCAATCTGCAAACCTTGGAGCTGAGTCTCCGCGTGC
GCTACGAGAGCTTTACCAATCGAGTGCTCACTGCTCTTCTCTGCAACAGCTACGAAACTCCAGAGTTGTGTCTTATCAACGCCGTCTTGGGGGGCAAAGA
CATTAGCAACTCCAAGTTGTGCAGTGGTGAGGGTACCCGTCTTGTCAAACACGACAGCATCCACTTCTTCAAGCGCCTCCAATGCGCGTCCACCCTTGAA
GAGAATACCCACCTGCGAACCTTTAGTCGTCGCCACCATGACTGCAGTCGGCACGGCTAGACTAATTGCACATGGACAGCTAATAACGAGCACCGTGATC
GCAAAGCGCAGCGCGAACGGAAAAGGAGCCCAGCCCTGAGTGTCCACATCTCCGTGCTTAGCGAGCGAATACCAGACCATGAACATCACACCGGCTAGGA
TGATAATGAATGTGGTAAAGTATGCAGCCACCGCATCAGCAATGCTCTGGCGAACACCGCGAGATGCCTGGGCTTCTCCTACGAGCCTCACCATACGTGC
TAGCATGGATTCGTGAATGGTGTGGGTTACTCGCATGGTTAGAACTCCCTGCGCGTTGATAGATCCACCGATCACAATCGCCCCAGGCTCTTTGGGCACT
TTACGAGCCTCACCCGTCACCATGGACTCATCCACTGAGCTAGCACCTCCAACAACCACGCCATCCGTTGGAATTCGTGTACCTGGAAGGACTTTAAGCA
GATCACCACGTTCCACCAGCACCACGTCAATATACTGTTCCTTCTCGTCCCCTTCTTCAAGCAAAATAGCAGTCTTGGCTTGCATACGCAGCAGTGCATC
CACACTGTTCGAGGCACGAGCTTTCACCAGTGTTTCGATGTACCGGCCGACGAGGATGAGAGTAACAAGCAGCACTGTGACTTGGAAGAAAGTATCAGCT
TTAGCTGGCGTCTCCACGAGAGACGGGGGAAGCGTCAACCCAGTCGAAGGATCAATCACTGCTCCTTGTGGTTGAGACTTGGCCAGTGCACCCGTAACAA
CAGTGAAAACCGAGAACGTGTAGGCTGTGCAGGCGCTTAGCGAGATGAGAACGTCCATGGTAACGCGCCCACCGTAACGCAACGCGAGGAAAGCGCTCTC
ATGTATGGGACGCGCCACGACGAAGAGCACAGGCGTCGCGCATGCCAATTCCACAGCATCTTTAACGCTCAAACGGTTTGCAGTACCCCAGAGTCCCACA
TCAGCTGGATTACTGTCAGAAGAGGGATACAGCACCGGGAGCACGAACTCGACGAAGATTACCGGCAGCGACAGCAAGCAGCTCCACATCAAGAGCCTTG
TAAATCGTCGTACTTCTTCCTCGCCAGCACGAACCGATGGAGCACGCGGAGTTGACGCTTGAACGGTAAATCCTAACTCCCGAGACAGTTGACGAACAAT
TCTACGAGCACCTGTGACGTCTGGATTGTACTCAACCAGCAATGCCTTGCCCTGTGAAGCTGAGGATACCGCTGGTTCATTAACATCTTCAGCAGAAACG
ACTCCAGCAATCTCGAGTGACAACTTCTTGGCTTTAAAGGAGCTCTCGGATTGACCAAGATGCAGAATGACACTCACAAGGTCGTCACTGGACAACACAC
TGGGCTCAAACCCCAAGGTGGCCACTGTCTCCTCGATATGCTTCGCCGTGACTAGTTGCGGATCGAACTGGAAGATCCCGCGACTCGTAAGCAGACTCAC
ATTGACGTCCGTGACACCACGCTGTGTACTCATGAACTTCTCGATGCGCGTACAGCAGCCACTGCATGTCATGCCACTGATGTTCAAGCGGAGAATCTCC
AGCGAATCACTTGTTTCCTTCTTCCGTCCTGAGCCTTCAGACTGAGGTCGTTGTTGCTCGAGAGAAGCTCCACGATCGCTGCGGAACTGCATCAACCGCT
TCAAAAAGCTGGGAGTTCTCTCCGGATGCGGAAGATCCTGCTCTTTGGACGAACAACAACCTGATCCGGGTGCTATCTTCTTGGTCTTAGAGGACGAGCA
GCAGCCATTTGAGCTAGTCTTCGGAGCGTCCGATGAGCTGCAACTAGACTTCTTTGTCCCCTTCTTGGAGGCACAACAATCGTCAGCTTTAGTTTCCAGC
TCTGGCTCACTGGAGCAGCATCCAGACGACGCCTTCTTCTCCTTAGACGCACAACAACCGTCGACTTCGATTTTAACCTCTGGGACCCTCGATGATGAAC
AGCAGTTGGAGCCGGTCGCATCCTCCTTCTTCTTCGACGAGCAACAACCTGACTTCTTGGGTTTCTTCTCGGACGCACCAGAGTCTCCGCAAGTCTCCTG
CTTCTTCGACGAGCAACAGCCAGCTTTCTTTGAGCGTTCCTTAGGCGGACCAGAGTTACCAGTAATCTCCTGCTTCTTCGACGAGCAACAACAAGATTTC
TTTGGTTCTTCCTTGGACGCAGCAGAGACTGCAGAGGTCTCCAACTTCTTGGATGAGCAGCAGCTTGATGGCTTAAGGTTTGTACTGGCACAACCGGCTT
TCACCTTTCCCACTGCAACATCCACGGGCTCCACCCACCCATCGGTCTCAGTAGTGTCAGCTTTGCAGCAACTAGCGTCGTCCTTGGAGCCTCCAATGGA
GGAGCTGCAGTTGTCCACAGTCTCCTCTTCCTCAGTACAACAGCCGTCAGCGCATCCTTCCTGTCCTTCAACCTCCTCATTCACCACGTCGACGTCTTCG
TCGCTGCTGGAGCAGGACACAGCGGTATCTCCTCCGTCGCTCTTGACACCGCCGCAACATCCACCAGCGCTCGAGGGCTCCGGCGTCTCAGTCGTCACGG
AGTCAGCCAGCGTCGGCGAGGCGTTCGAACGACGTCCTTTGCGTTTTCCCATGAGTTTACTACTGTATCTACTTGTTGTCGCAGGGTGGCGTGTTGAGCG
CGCGGTGTAATAAAGACTGCGGGACTTGTACTGGAAGGATTCGTACCGCTTCAACAAAAAAAAGTTGTTATGATATAACGTTGCGCAAAGGCAACGTAAA
AAATTCTATGTTGCCCAAAAATTGAGATTAATGTTGCGGATAATTCATGATTGCATGAACATTTTGGTCGATTTTTGAGGTATCCTAACCAAACGAATAT
GTATCATCATAAGTTTTGCGACGGTCGTATGGTAACCCGGGTCAAGTTGACCCGGTCAACGCCAACCTGTTCAAGCAAATTTTGCTCAACATCCGGACCG
GGCCGGATTAAATTAACCGCTGAACCGCCGATTTGTGCACGGTACCTCGTTTTTGCGTACGCCACACCATCTTTTGTGGTTGGCTGTCGTTTGATCTTGT
CTGACGCTTTATCTCGCTCAGTTCTTTTCAGACAGGTAAGCTGCCACCGTTATGTCGAGCGGCTTTTAGTCCCTGCTCTAATGCTCATATCTACATCTCA
GGTATATTCATCACCATGCCGAAGACTGCCAACGTCGTCCTTGCCCGTGGCATCAACGCCATCTCTCGCAACAGCCTCTCGAAGAAGAATGGCCGTGGCA
AGATGATCAAGAAGGGTGGCGAGAAGAAGGTCGCCGCCAAGAAGGTGTCCACCAAGAAGTGGTACCCGGCTGACTACATCCCGAAGCCGCTGCCGTCGGC
CAAGACCAAGCGCAACAGCGTTAAGACCGCCAAGCTGCGCAAGTCCATCACCCCCGGCACGGTCCTGATTCTTCTGTCGGGCCGCTTCCGTGGCAAGCGC
GTGGTCTTCCTCAAGCAGCTCGCTTCGGGCCTGCTGCTCGTCACTGGTAAGTCACAGCTTGCATTCCTACAGTCTCGACCTGGAGCCGGCATTCCGATGA
TGCAAACTTGACACTTCGAGAGGCGCTCTGCCACCCCCTCATTCGTCTGTGATGCTTCCACGTCTCGTGCCTCGCGCCGTTCGGCTTCATCGCACCACCC
TTTTATAAGGAGTCTGGTGTTGGTGTTGCTGCCGTGGGGCATGCGGTTTCCGATGGTTGTATACACGGATAGGTGAGGGGTGTCTTTTTGCCGACGATCC
ATCAGATTATGAGACCTGAGGAATGTCGGATTTAGGGGACAAGGTCACACTATTTTTTATAAGGCTGTTGCTGACTGGTTAAACTACATTATTCAGGCCC
GTACAAGGTCAACGGTGTGCCCCTCCGTCGCGTGAACCAGTCGTATGTGATCGCCACGTCGACCAAGGTGAACGTTGAGGGCCTGGAGCTCCCTGCCATC
GACGACGCCTACTTCGCCAAGGAGAAGGCAGCCAAGAAGAGCAAGGAGGAGCAGTTCTTCGCCCAGTCCAGCGCCGTAAGTTCCCTATTTCATTTTTTGC
TATCCCTTGAAAGCATCCCGTTCCGGTTGGTCGGTTCTTCGAAACCACTACACTCGATCCGCCCACAACCAGCAGCGTAGTGGTGACGCAATGGAGTATC
AAGATCGACGAACCCTATGAGATCTCTCTTGTTCTTCGATTGCTGAACCGCTTCCTGTGTGGCAGATCAGACAGGGAGCTCAATGTCTTTAGACACAGCT
TCCTGTCACACCATATGAGCGCTTGGGATCGCTTGCTTCGGCATATAAGCTCCCTATAAGAGACTGACCGTGTTGCTGTTAATTCTCTAAGGCCCCCGTC
ATCTCGGAGCAGCGCAAGAAGGACCAGAAGGCCGTGGACTCGGCTCTGATCAAGAAGCTCGATGCCGAGCCGTTCCTCAAGGCCTACCTGAACGCTAAGT
TCTCGCTGACCAAGAACGACCGCGCTCACGCCCTCAAGTTCTAAGTGCGCTCTTGCTATCTTGTGTAGTAGCATGGTGTGCAACGGAATGAGATGAAAAG
AACAATATACCTGATGAAATTATCACCAACTTTTAACTTTTCATTCATCCTAGAATTTCGTCAAGTAAATCTTGAAGTAAGATGCTATCGCTTTTAGAGT
CGTCATCGTATTCGCTATTGTTCTCTGATGCGAATTTCCTAGTTGAGTGAACGGTATCACTCTCACTCGCTAGCGCGTTGTAGCTGGAGCTCTTCTTGAT
GGAACCCCCTTTGAAAAGGCCTCCACCATTTTGAATAGGGGGGACAGTTTTCGTATCAGCTACGTCATCATATACACCAGGACGAGAACTGACGAGCGAA
GATCCCCATTCTTGGTGCCGTGAATGAGTCTGCTGTCTCTCCTTGGCAGTCAACAAATGGTGTTCTTGTCGCGATGATAACCCACTTCCAGCCCAATAGC
TTGAAGTCTCAAGGTCATCTGACTTCTTCGCACAGACACTTGATCGTCCTGTATAGCTCGAATAGCCTCCGATAGACTTGCAATCGCCCCGGAGTGGCAA
TACGGGCACTTCTTCCACTGGCATCACTAACGGAGGTATAGTTAATGTAGGTCGTGGCACAGCTTGGTCGAAAAAGCGGTGTTGGAGCGCTTGCGCTGCT
GTAATACGTCGACTAGGGTCGTATTGTAACAGATCTCGTACAAGTTGAACAGCTGAGGAGGGTGTACCTGAAGGCAGAATTCGCTTCCAAGACACTGGAG
TACACTTAGGAAATCGAGCTTGCATGTGAGAGGCCATTGCTGCACCTTCGGGCCACGTTTCCGTAGTAGGTGTGCCAAGAACTTTGCAGATGCGATAGAA
TTGATCCGCTTCGGACGTTCCAGGAAATAACGGGGTACAGATCAGGAGCTCAACTAATATACATCCACAGGCCCACATGTCGATTGGGCTGTTGTATGTC
GTTGAGTGCAGCAATAGCTCTGGTGCTCGGTACCATCGCGTTGCAACATAGTCGGTGAATGGTGGCCGTGATCGGATCTCACGAGCTTGACCCAAGTCTG
CGATTTTAAGTGTATCATCGTGACACAACAGGTTTTCTGGCTTAATGTCGCGGTGGAAGAAGCCGTGCTTGTGCATGTATGCAAGACCACTGAAAAGCTG
GAACATAATCGATCGTATCTGCGCCTCCGAGAACCAGGGATGCGGCGGTGAGGATGAAGTGGACGTGTCGGAACTCGAGCTTGTATCGCCACCAAAACCG
CTGTAGCTGTTGGCACTGACTTGACTTTTAAAGTTACGCATAACTCGGAAAAGCGACGTCTGCAGGTACTCGAATACGAAGTAAAGCTCTTCTTTGTCTC
GAATAACCTCTTTCAGCAACACAATGTTATCATGGCGCAGTATTCGAAGCGACTTGAGCTCACGCAATTGGAGGCACTCCTCCCAAGTGGGAAATATCGC
CTTGATCTTCTTCACAGCCACAATTTCCTTCGTCTTAAGACTCCGAGCACGCGAAACTTCACCGAACGCGCCATCACCGAGTTTGTCCAGTATCTCATAA
CGATTCATCTTCTGCTACGTGAATTGTAGACTCCTCGACTTGACTGATGAGGCTTATTTTTTAATTTGCTGGGTTATTTTTACAACCAAGCCACAAACAA
CATAACACAAGGTGACGTCAACACTAGCAAGAACCCCTTGTTGCTGAGTATATATGGTCTACGTCGCCTATTATGTGGTCTATGACGCCTTGGTAAGCTT
GCTATAGCTCTCAATCATCCATCGGAGTGTGCGTGCTATCGTATCAATGTCGACCTTGTGGAGTGCACTATTATAGAATCACACCTGGTTAGGAAGTGTT
GTGAACAACAAAGACTTTCAGCGCTTACCTGACTGGAAGCACAGCAAGATCAGTGGACTGGCGCAGCTTGTGAAAGCTGTCTTCGGCGCCTGTGAAAATA
CCAAAACGTATTGTTAAGATACCCGACAGCACTGGATGACGACATCATCGCAGAGATAATATCTATACGGGTGCAAGTCGTACCTTGCTCATCCATCTTG
TTGGCAACGATGAGGGAAGGACGTGACGAGATTCCTGGGGCATACAGCTCCAGTTCCCTTTGGAGATGGGTAAAGTCCTCCAGGGGATCACGTCCCTCTG
AGCCCGCGGTATCAAGGACGTACATCAAGATCTATATTGCCATCGTCACGCAAATTGGTTATCGAGTATCCAGTTCAGCATGCCGGACAATTTCCATACC
TTTGTGCGCTCAATGTGACGCAAGAAGTCGTGACCAAGACCGACATTGCGGTGCGCACCGTCGATAAGTCCGGGAATGTCAGCCACACTCAGCCGGAAAG
TGTCTGGGAATTCCACAATGCCCACGTACGGGTGAAGCGTCGTGAACGGGTACGGCGCGATCTCAGGCGTGGCGCGGCTCAGCACACTCAGCAAGGTAGA
CTTGCCAGCGTTGGGATATCCAACCAAACCAACATCGGCAATTGTCTTGAGCTCCAACTCGTAATACTGCGACGTACCCGGCGAGCCCGTAGTTTTGCTC
TCAGGCATGTGCTTGCGCAGCCGACCGAACTTGGTCGTCTTTCCAGCCAGGATGCGGTTGCCCAGTCCAGGTTTACCGCCCTTAGCAGCGAGGAAGGTAG
CACCAGGTTTGTCCAAGTCAGCGACAACTTCCATCCTATCTACAATCTCATACTCGCCGTCCTCGAGCTCGCGCTCGTAGCGCTCCACACGCTTGACGAG
TGTGCCACACGGCACCTTCACGTGGCAATGCTTGCCCCTCCTACCCGCGGAATCGTTTGCTGCAGCCACACAACAAATACCAACATAACAGTCAGCCTCA
CTAAAAGAATTGCACTCAACCACAAATCATTGCAGGACGTACGCATGCCGTTGGTGCCTGCTCCGCCCTTGAAGTGGTGCGTGGCGTTTGCCAGATTCTG
CATCTTATCACTGGCTTCGATCACCACGTCGCCTCCAGCGCCGCCGTGTCCACCATTGGGACGTTTGCGCATGGCTGACTCGGAGAAGAAGCTCGCGCAG
CCGTTGCCACCGTGACCTCCCGTTGCCTTGACGCGGATGCGGTCCACGAAGCGGCGCTTCGAGTGCTTCGCACGCCGAATGCTCACCTTCTGCTTCACGT
GTTCCTCCACTTTACGGCGACCGGCAGACGCTACATCGCCATCGTCGTCCAGCGTCCAGTCATCCAGCTCGAGGTCGTCCATGTCGTCCCAGTCCAGCTC
CAGGTCCTCCAGTTCCAGGTCACGGTCATCATCTTCATCGTCACCGCCTTGAGCGCTGAATGCACGCACCGACGAGCGATTGAAGATGGTGCGGCGACGC
ACCGGTGCAGCGGTTAAGCCTCGGAGCAGGTTGGACACGCGCAGCATGGTTGACGTCTTCGAGCTTGGTAGCGGTCCAGCACTTCGATGGTTGCCTTGGT
ACTGTAGCTAGTTTCAAAAGCACTTCGAAGTATACACACACCACATCATTTTCCAAAATTGCGCATCTCTCTCTGGACTATTTGGGGACCCGCATCTTGG
TTTCAGTATGCTTCTTTTATAAAATTCCACGCTCGGTTTGTGATGCGTTACTTTGCGATCAACCTAAAGTAGCGCAAAGTAACGCTTAATTGCGCAGCGT
AAAAACACTATTTTTGTTAAATCAAACGTAAAACACTTTTAAAAATGTATTTTAAATATTTTTACATTTGTTTTTAAACTAAAAATGGTGAAACAAAATC
AAATTACAATAACTGGCTAATAATAAAATCAACCAATTATTGTAATTCGCCATTCAAAAAAGGTGAAACGGCAAGGTTTATTTGGAACCCATCTCAAAAT
AGTCAAATTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAACATAGTTCCAAAATCTCGTCGTGACGTATGTTGATTGGCTCG
GGGATGGCATTCAGACGAAAAAAACCCATTAAAATTTTAATGGCTTTTTTTCGTCTGAATGCCATCCAAGCCTATATTATTACGACCCAACATGTTTTTT
TTTTGAGTTGGATCCGAATAACCCAAATAAACCGTACCGTTGGATGTCATTCAGACGAAAAAAAAAACCATTTAAATATTAATGGTTTTTTTTTTTTTCA
AAGTTCGTTCGAGTGCTGCCAAAGAGTGAGTGTCATCGAGGACAGCAAGGGCGAACGCTCGACAAATGTTGTCAACACGCAAGGGCTGCGAAAATCAGCC
GGATATCCGCCGATGACTTCAACCGCCTCTATGACAGGCTGGTTGTGCGGCGCACCAGCAAAAATAAGCGTGCGAGGAGGCAAGTGACCACTGTAGTGTC
GGTTAATTCAGCTGAAGATGCCAAGGCGTTGCAACAAGCATCCGAAGCTGCGAGACTGGAAAAGACCAGGCACCAAGAGCAACTGGAATGCGACGCAAAA
ATCGCTAGCACAGTGAAACGACTTCGCTTCGCTAGGAACCTGCGCGGCCTCGCGCGGTTGACGCACTGTAATCCTCATCAGCTCGCTTTCCAACTCGTAG
ACGCGACTGAAGAGGAACAGCGTCAGATCCTATTAGTCGTGAAGTAGTAAAAGGCTCAGAGACGACGGCATGAAGAACGCACTTCGGAGGTGGAGCGGAG
CATGATACTGGAAAGAATTGTTGCCAGGTGTGTTTCATTCTGTGCTGCAGCTACCACACTGTTGAATTGTATGTTGATGTGTGAACTGTGATGTACATGT
AGGTTATTTCTTCGTCGCGCTGTTGGCTTTCGTCCTGACGCAGCTACAACACTAGAGGGAAAACCCCGCTTGATTGATGAACTGTTGTTCTTCTCGTATC
CAAACCCCGACATTGTTATCCAGAATCGGGTACGCGGAGATAGGAAATGTTGTACCTACTCCACAAATAAAACTCGCGACCAAGGGAACAGTTGAAGACA
TGGTACATAATTTAATGTATTTGTGAAAATTCAACTAGGGCCTAACCTTGGACTCACCCAGTCATGTTGTACTCGTGATAGAGCTTCGACTCATGAGTAA
CCGAGTCTCTGTTGCCCCAGCGTATCCGTCTTTGGAGAAGGCAAAACCATGATATCCCTTCTGTAGTGTCGTCCTGTGCTGCTGGGTTCGGCCGTTGGTT
GGAATGATGGAGCCACTTTTCTTGGCGGCCCTTTTCGTATGGGGAAGCCGAGCCGGTACTGCCACTGACGCGTTACTATTGTCATTCCATTGCAAAAGTT
TGCGGTCAAGGTTGAATTTTGTGACCTCCTTCGCGAGATGCCAGTACTCCGGGAAGAACGTCGATTTGATGCCGTTAAGTAAATGTGCATACGAGAGTGC
AGCCACCGGAACAAACAGATAAATTAACCAGAACGATGGAAGCACAAACGCTTGTTCCAGCATGAATTCCCACGTGAGATCCGAGAGGAAGTAAATGTGA
CTGCATACCAAGGCGACCAGGAGCCACATCAACACTGATCCAATGTAGAGAACGTAGTTGAAGAAATGGAAACTATTCTGGAACATGAACAACTTCGAGT
TGGCGATAGATACAACAAGGGTGAAGACCAGGAAGCCTTCCAACCACATCGTCGGGCTTGCACCAGCATAACCCGCGCTTTGCAAGCTGTGAAGCGTGAT
GAACGTGATGATGACACTTTCCACAATTGCACCCACGACCCATAGCGTAAAAACACGAGTGTTGATGTCTTCATCACGAGGTCCTGTAAAATAAAGTTTT
GGAAACGTCATGGCCACATCATCGCTGACATCTTGATCCAAGATCGAGAGTGCAACGATAGGGATCGCAGTAAGACAAATGTTGTACAGCTGGGTACCGC
TCTCCAGGAAGAACTTCTGCCCGGAGAATCCACACAAAAGAGTGTACCAGTACTGAGCTGCGGTGAAGAGAATGTTCTTATAAAAAATGTACAGCACCAG
CTGAGCCATGCGTCGGTAGTTCCAGCGACCGTGTACAAGCAGCAGACGCTGTAAAAAGCGAAACTGTGCAATTGCGTAGTCACTCGAGTTCACTGCCTGC
ATACCTTCCTGACCTGAAATACCGACACCAATGTGGGCTTCTTGGATCATTGATACGTCGTTGGCTCCATCTCCGATAGCGAGAGTTCGAACACCAGGTA
CATATTCCTTGATCAGAGCAACCATTTCAGCTTTCTGAGCTGGTGACACTCGGCACGCGATAACAGCTTTGCAGTACTGAGAGAACTCGGCCAAAAGTGG
ACGACATGATCCACGGAGAGCGTACATGAGAGTCTCACCATCAATGACTAGAGCCAACTCCCGCAGTTCACCTCTGGTACTCGGCGGTGAAGCAAAGTAG
ACCGTGACATCACCACTACGAACTCCAATTTCATCTCTCAGAGTGCTTTCGAGTATCTCTGCGGTCGGCGCATTCTTTGAATTGATGATAAAGAGCTTCA
TATCGTTGGTAACAAGTTGACAAGCAAAGCCGATGTTGATGGCAGTCTCCTCTTTGTCGCCTGTGAGCACCCAAATTTTGATTCCAGCAGACGCTAAATT
GGCGATCGTGTCAGGGACTCCTGATTGCAGCTTGTCTTCGATAGCAGTCGCTCCTAGCAGCTCCAAGTCGCACTCGATCTCATTCATACAAGCGTCAATC
TCGTTCGGGAGGTCCTTTTTGCGCTTGTCGATTTCATTTAGGTTGTTTTGGGCGTCATGGAAGCGTGTTGCCCACTCCGCATAATATGAAGGATCAATTT
CACGAACAGCAATCGTAAGTGTGCGAAGTCCATCTTCAGCGTACTGGTCGATATGCCGCCGGGTGATCTCCTGAAGCTGAGAAGAAGTCGATTCTTCCTC
ATTGTCCTTCTCGAGAAGGCCATAAATGATCACATCAGCGCCTTTCGAGTACAAAAAGATCCGGCCGTTCGGGTGGCGAATAATGGTGCTCATGCGCTTT
CGAGTGCTGTTGAATTCCAGCACGTCCAGCATCTCGTATTTTTGAACAGTTCCGTGGACTTTGACATGAGCTACACCAGGAGATCGATTCACAAATTCGT
ATCCAAAGAAGCCTGCACCTGCAACCAGAGCTTGCTCATCAGGAGAAGAAGCCGAAAGCGTGATTTCTGACGAATTCTCATGACGTTCCGGAATGACGGT
ATGGCACACCGCCAGGTGCGTGAAGAACGCATCGATGCGTCCTTGCTGAACTGATCCCGAGTTGCCTTTCATATCGTTAAACAACTCTGGACCGTCGAAG
TTCACATACGGCACCTTGGGTCCTTTTGATTGAGTAGTCATGTCTGGAAGAGGTTTGCCAGCACGTCGGAGAGCTGCTAACCCAATTTCCGTAGTTCCGT
TGCCGTAGGAAACGCCACCAATTGAACATTTTCGGAATTCCATAACGTTGCAAGTGAGAGTACCAGTTTTATCCGAGAAAATGTACGAAATCTGCCCAAG
CTCCTCATTTAGCGACATAGAGCGAACTAGTGTCGGCGTGTCCGTGTCAGGATGGTAAATGTTGATGTCCCATTGGATAAACTGAGCTTGGAGATATTTA
ACCATACTCATGGAGACAGCTAGCGAAATGGGAACAAACTGGTACATGAGTAACAAGTAGTAGAACCACATGATGATCCAGTCCACGACGACGCTGTTTT
CTGACGCGGTCAGCTGGAGGTACCACAAGGAGTCATGGTTTGTCTTCCATGTCACCGCTCCTGTAGCACCAACCGCACTGAAGATGACCAAAATCGCCAG
CAACACGACCGTGTACTGGTTAATAGACCGGTCCATTGAGCTCATTTTTGATGGAGGGGCAGAGTTACTCATCATGATCTTCGTATCCTTGCCGGTGTTG
AAGACCACACCGTGCACCCAGTCGGTGTTGCGAATGATACATCCACGTAGGATAATACTTTCATACGGAATGGAAGCCTTTTCCTTTCCCTCGAGCTCGA
GTACACCTTGAAAACTGTTGATGGCATTGTTCGGGTGCTCACACCGAATGGCACCTTTCATTCTTAGCAAATTGTCAACTGAGCCCATGTCTGCAAGTGT
GCATTCCATGGCAGATCGGACTTTCATATTGGTTTCTCCATCCAACGACTTCGTTTCAACGTAGCAAATACCACACGGTGACTGGTTCGGAATTTCACTC
ACCGCCAGCACGAGCATGTCGGCCGGTACCAGTCCACGGTTGGTAACTTTGATAATGTCGCCAACCACGACGTCAGCCCACGTGACCTCTTTAAATGTAT
TAGTTTCGCGATCAAGCACGAGGGTTGGACTTGCATTGGCAATATTGTCGGCTTGATGACGCTTGTGGTCTTCGAGTATAGCGAACACGGCATCAACCGT
GATGATGAAAACTAGTGGAGGTAACGTCGAAGGATTTCCATTCGTGTTACTGATCTCAGGGATGCATTGCAGGATGCAGATGACGAGGAAGTAGAGATTG
GAGAGTTTACGAAAGCTCTCAAATAGGAACTTTGGTAAGAAACTCGCGATGGTGTATTTGGACGTAACGATGAAGTTATTGCAGTAGCCGGCTTCGATGT
TGCGGTGTGCGTCATTAAGATAGACCACACGGAAGTCCCCGGCATGCCCTGCCGTTCCTTCACCCATGGCACAGCCACAACCAGAGAGACAAGCAGGAAA
TAAGGAGGAAGAGCCGAGTGCTGCTGCGATCGGCAGAGTGAGGTCGCACGATGCAAAATAACGGTCCACCACTTTGAATAGACCAGGACGAGCACGGTGC
GATGTGAAGCAAGGAGTTTCGCGACAAGAAAACCAACTATTTTTACGGTGGAGCGTCTAGCTAAAAGCGATGGAGTTGCTGTCCGTCGACTTCATGGCTG
TAATGGTTCTCGAAGCAACTTGTACAGTACAACAACTAGCGCTTTTGTTATTAATACTACCCAGTATCTAAAGCGACAGGGGTCTGTTCTCACCTCTCCG
TTGTTGAAATGATTTGCATACAAAGTTTGTGCCGAAGTTGCCTTTCACTTAACTTGTCGAACTCAACAAGGTGCAGAATGATGGTCTGCTTCAAGTGCGG
ATATCTTCTTTCCGTCTCACTTTCGAATTTGCCAGCCCAGATACACGTCGATGAAGACACAGCGCACTCACCGGCGCAAACTGAGCTTCGCCTCCTCGAA
AGATGCCGCCCCGGTAGCGACCGTCAAGGTCGAGTGTGCCCCCGAGCGGCCTATAAAGCGACGCAAGCGCCAGTCATACCGTCGTTTTGTCAGTCCGGTG
CCGATACGACTCGAAAACAGCCTCCCTGCAGCCATGTGGGGCAACATTCAAGAGCAATTCGCAGCAGCCAAGAGCCTGGGGGACATGTACGTCTAACGAT
ACTGCCGTAGAAGGAGATACAGCTGACGTGGAGCCGTGATGCCAACCAGAACGCGCATTGTGTTGCAGTTCTTCACAGCGCACGAGAGCCTCCAGGGCTC
TTCGACCGGACCTGTGTTTCCCATCTTCGTTCCGTCCAGTGGGATCTACAAGATGAAGGGTAGGACGTGCACATTTCGTCCTGGTGATATTTGACCTGAT
GATCGCTACGTAGTGCCGAGAAAGAGACGCATCTACGACGTACTGCACGTGCTGGAAGGTATAGTTTCTGTGGGTTTCTAGGAAGAGGAACGAGGGTATG
AGAACGTTTACGACTACAGGGATTGGAGTCATCAAGCGGGTTCGCTACGACGATAGACGCCGGACAAACGGAGGCTACTTCTTGTACTATGGGAAAGCTG
CGGTGGTGCAATATCTGGCGGAGATGAAGAGCAACTCGGCTCAAGTGATGGCAAACTTCCGAAAATCTCGTCGATCTAAGCGGACCAGCATTGTGGAAGA
AGACAGTGCTCTTATGAGAGTTTTCGAGGACCAGGCGGCAGCTGGCAAGTGGCCGTGCTTGGTGAATATGACAGTCTGCTTCCTGGGCTTGCTGTTTCAG
CAAGACTGTCAATATGAGGTGGGATTACCCACCTTAAGTGCCCGTCTCGGTGAAGCAAAGAAGTTTATTGGTACTTTGCTGTCGAACTCGTCCACAGAGG
CTCCTTACCGTGACGTGCACCGCCGGGTGTACGATGTGGTGTCCGTGCTGGTGAGCTGCAATATGATATCGACGTCATCCGCACCTTCTTCCGAGCCTAT
GGACAAAGGTTTGCGAAAGTTCATCCGATTCAACTACGACATTTTCACGGACCCACGGATCCTGTTTGCCGCATCTGACTCCGTGGAGCAGTGGGTCGGC
GAGACGAGCGATGAATCGATGTTTGGTGATATGGTGACCAGCTTGTGTGACCTTAAGAGCCCGAAGCCGGAGGTTCTAGATGACCGCATGGCTTCTACTC
CGCTGACTTACTGGCAAAGTCTGCACAAAGGAACATCTTTGACTGGCTCGACAGTATTTTCACCGGTGACCATTCTACAGTCCGAACTGCTTCCGTACAA
CGAAGGCAAGGAAGTGGGTTTACAGCGCGGCTCAAGCTCACCGGGAACCGTCGCGAGATGTCGACCAGAGGAAGCAGCACGTGTTCAAGATTTCTTTTCT
CCTCTGGGAAGGTTGCCGAAAGAGAACAATGACTGGTGTGTCGAGTCACTGAAGCAACTCGGACTGTACGATGCTCTTCCTGCCGATGACAAAATCGATT
GGGAGCTGAACAAGCAGTTGAAGGAAAACTATCGTGAGATGTGGGGCTGCCAGTACCCAGGAACAGCTTCAGTCGAGTTGCAACCGGTTGACAGAATGAA
GGTGAGGGTGGTAGATCTCGAGTGCTATGAAGTACTGGATGGTGACGTAATTGGGAACACCGCCAATTTCTTTTGCTGATCACGCCGCTGTGGTCGGAGC
TTGATTTTGGCGACTGCGTAACTTCACAACACACTTTTGCAAGTCGGTTATATTGTTTGCACTGCGTTCACTTGCAACTGCATCGCTACAGCACTCCACA
AATGAAGTTGGATTAAGCAAAACTCGACCGTCGAACTGCCAAGAGGATTCAGACTCCCAGCCAACGCTTTTTGATTGTGTCGTGGCCCACGTTAACCTTG
GTAACATCAGCTTCCGAATCAAGCGAGATTACAGTGGTCTCAGGTCCGAATCTCGTCCTAGGAACCGTAACGAGTTGCAACGGTGTCGACCAAGTCGGTG
CAACATGTTCAGTCCGCAGATTGCAGTTTTCTTTTTCATGAACCACTTTGCTGCGCTCAGTTACAGGCGCGCCGGTTTTCGAGCTGATACTGGCCATGCC
AGCGCATGGCATGGCATGGCAGTATCTGCAAACTTTGTGATTAAGGGATAACGAAGACTTCAGATTGCTCTGCACCATAGACTATGGTCCATAGTCAGTT
AGTCAGTTGCTTAGTCTAGCGCCGCCAACCGTCTCACGCTCTCTTCTCAAGGTGAACTTGGCCGTTATTTCTGGTCGCTGGGAGGTAGCTGCACTAGCGC
CGCGCTGCTGCTGGAGATCGCATTGCGCGGCATGTATCTGCTCCTTGATCAGATCCAGTTGCGCTTGGGTGGCCCTCTGTTCTACTCGCTCTGTTCTCTA
GCTGATCTCGGAGCTCGATGTTTTCGGCTTGTGCTGGCTCTAGCTGATGCTTCACGGTGGAGAACTCGATTAGCAAGTGGCGAACCATTAGGTTTGAACG
TTTTGGTGCGTTGGTCCAAGTCAGTGTTGTAGCTCACTTCCTTCAACGGGCATCAACTCCAATAATGTCAACAAATAATGTTACTGTATCACTTCAACTT
GGACGATAAAAAAGGCAACAGAATTACATGCAAGTAAAAAAATGCTTTGCTTCTACGAGTATTGACTTAACGCTGTTGCCAATTTATTGGAGAGCTGGAC
TCACTGCTCATGAGGACCGTAAACGTGCTGACGTAGCTTGGCGCTTGTTCTCATCGCATCATTCCGTAGGTAGCGCTTATAAATCCTTGCAGAGACTTTA
TCGTACTTCATCCAGTACCCACAGGTCAAAAATCGCTTGGTTTTGATGCCCGGACGCGAGAATCGAACGGTCGCCTTTGGTGGCCTGCGAATAACTTATT