Description :
From Genome Similarity Track
Location :
Scaffold_329:16046- 17166
Transcript NameFunction/comments
Phypl_g7044hypothetical protein

Sequence
1120 bases(100 bases per row)
TGTGATACATCCACCGGAACCAGCAGCGGTGTCAGCTAGGAGGAGGATGCCCCCATCTCCAGTGGTAATCTCATCGATGCCTACTGCTGATCCATCTAGG
AGTACAACTTCAGCACCAGTGCAAAGTCCTGCCATGTCAACTGCAGTTGCTCgatctgcatctgctgccaCGAAAAGTGGCAAGAAGCGCGGAAGGCGAC
GCAAGAACCCTACAGCGTCAAATGGCACACCAGGTAGCAGAGGAAAAGGCAAGGCAAAGAAGTATTCGAAGCACCAACACGAGAGTAATAGGGTGGATGC
CATGATGGATGACGGTGCGTACATATCTGTATTTCTAAATGTACGCAGTGATGTGGTGGAAACTAACTGAAGTACTGTTGTTGTTCTTGCAGAGGAATTG
TATGCGTTTTCTTCAGGCTCCGATTTGGAAGAATCGCCATCCAAGAAAGCTGCTAAGGGTCGACGTCGAGGAGTTACCGACCGCACGCGGCATAGCCTTA
CCGTGGACCGGTTGGTTGGGATGGGATTCACACAAGAAGATGCGGAGGCTAGCGTGAAAGATATTGGCGACGATCCGGATGCCTGCATGGTTTGGATTAT
TTCCAAGATTGAGGAGAGACAATTTAACGAGGATCTCAACCGGGCGTCAATTCAATCGGAGCAATCAAAACgggacgaggagaagcgagtgaagaagatg
gagaaggaaaCGCTTGCGCACGCCACGAAGTTTATGGCCCTGTTTCCGACAGTGAGTATTTTCCCCTGGCGACATTTGTGGCAGATTTTGTTTCTGTACG
AGTCGACTAATGTACCCTTTACTTGATTCTTTGTTGTAGTCCTACATGGTTTGCCCCGAATCTACTGCATCACACTTGAAGAAGTTCTTGCAGTCGACGA
TTGATCATGTAAATGCAGAGACATATATTCGTGAGGTCCTCTCCAAACTCCTGGCCCTCGAAGGCAAGTCTATCCGATGGTACAAGGAAGCGTCCAGGTC
CTACATGCTGGAGCTTGCCGGACGCCTGGATGGTGTGTTGCAAACTCACGAAGTAAtgacctgctgcgcgcgtgTTTCCGCAAGCGAGGTCAATTCTCCA
AATGGATCTTGTGCGCTCGT