Description :
From Genome Similarity Track
Location :
Scaffold_18:160458- 161834
Transcript NameFunction/comments
Hyaar_Emoy2803184myosinlike protein putative

Sequence
1376 bases(100 bases per row)
TTGCTGGGGTACGAGATGTTCCTCCAATCGATGCCCTCCGCAATGTACACCTGCTGCTCGCGTTCGAACACGAACTCATTAAACTGTGCTTGCAGTCGTT
CGTTGGCATAATTAATGCAGAGTTGCTCGAACCCATTACTATTCAGGCTCTCAAAGCCAAAGATATCGAGAATGCCAATCGTAGCCAACTCGTCGCTTTC
GTCCGAGATCGACACGGCCGAGTCATAGTAGTTGATTCCGTCACTAAGACGACGCACCAGCCACATAAAAAGTCGACCATACACAGCCTTCGCTAGCGAT
CGGCAGATCTCTTTCGCCTGCACCGGATCATGCTTCAGCACCATCACCTCCGCACCAGCCTTAATCTCTCGACTACTCAACAGCGTCTCCAATTCGTCCA
CGCTCACACCCATCAGTTCGGCACACTTTTCCAAATGAAACCGCGATTGCGCAGTCACAACGGTAGCATCACTTTCCTGTCCACTTGCCACCGTAAAATT
GACGTTGCCAAGATGCAGCAATGCTGCCAGAATCTTAAAAATCGCGAGTCGCTCCGGCTCTTCAACGCCCGTGTCCTCAAAAGCCCGTACAGTCTCGACG
AAAAGCTGCGCGTACCTCTCCGTCATCGCTCGCTGTCGCGCAAACCGAGGTCCATATGAATGCAGTAGCTCGTATGTCCCTCCTCTCTCCAGTCCCAATC
CACGCAGCAGCTCCGCGTCTGCGCCTTCCAGCAGCTCGTAGAAAATGTGAAAACTCCGTTCCCCTGGATTCTGGTGCAACACGCGCACCTTCTCGAGCAA
GTAGCTCACGATCTGCGCCCCCACGATCTCGTGCTGGGCACTGAACTGGATCTTAATAAACTTGCCGAAGCGACTCGAGTTGTCGTTCCGAATCGTCTGC
GCATTCCCAAACGACTCTAAGATCGGATTCGTCTGCAAGATCCGCCGGCCAATGTCCACTGCGCCACTCGTTTTGACAGGGTCCGTGGCCGCGTCCCGTC
CCACGCTCGTCAGAAACTGCATGAGGAACTTGGTGCTCTCGGTCTTGCCACTCCCACTCTCGCCACTCACCAAGATGCTTTGATTCGTCCGTCCCGTCGC
ATTCCATAACCCGCCAAAAGCTTTGCCTCCAATCGCAAACACATGAGGCGGTAACTGTCCTTTCTTGTCCGCCGCATTGCCGCGGAGCGACAGGGCCGAC
GCAGACGGGCGCATCGTGCGCTTATAGGCGTCCAATTGCGTCGCTGCGTAGAGCGTCGGGAGCGGTTTCAGCGGATTCAATGCCACGAGAATGTCGCCAA
TGAACGAGTAGATCTCATTGAGCGCAAAGCGGTCGCTCAGCGCCTGGAGGAGCGCCGCTTCGTGCAAGTGTTCGAG