Description :
From Genome Similarity Track
Location :
contig_39:160454- 162383
Transcript NameFunction/comments
g8525.t1POM74099.1 Chaperone dnaK [Phytophthora palmivora var. palmivora

Sequence
1929 bases(100 bases per row)
AACTCGGCGTCGTGCACGTTCTCGTCCTTGTTGTCGTCGCTGGCAGCGCCCTCGCCCTGCTGCGACTTGTAGACGGCCTCGCCGATCTTCATGGACATCT
TCTGCACCTCCTCCAGAGCGGCCTTGATCTCCTCCGTGTTGTCGGTCTCCGACTTGGTCCGCAGGTCAGCCAGAGCGGCCTTGACCTTCTCGAGGGTCTC
GGCGTCGATCTTGTCCTCGTGCTCCTTCAGGGTCTTCTCCGTCGTGTACAGGGTCGAGTCGGCGTCGTTCTTGGCCTCGATCAGCTCCTTGCGCTCCAGG
TCAGCGGCGGCGTTGGCCTCAGCGTCGGCAACCATCTTCTCGATCTCCGACTCCGACAGACCGCCACTCGACTGGATCACAATGTTCTGCTCCTTGCCCG
TGGCCTTGTCGCGGGCGCCCACGTTCACGATTCCGTTGGCGTCAATGTCGAAGCTCACCTCAATCTGAGGCACGCCACGCGGGGCAGGCGGGATGCCCAC
CAGGTCGAAGTTGCCCAGCAGCTTGTTGTCAGTAGCCATCTCACGCTCGCCCTGCAGCACCTTGATGCCCACCTGCGTCTGCGAGTCAGCAGCCGTCGAG
AACACCTGCGACTTCTTCGTGGGGATCGTCGTGTTACGCGGGATCAGCTTGGTGAACACACCGCCCAGGGTCTCAATACCCAGGGACAGCGGGGTCACAT
CCAGCAGCAGAATGTCCTTCACGTCACCGCGCAGCACACCACCCTGGATGGCAGCGCCCATGGCCACGACCTCATCGGGGTTGACACCCTTCGAGGGCTT
CTTGCCGAAGAACTCCTCCACGGTCGTCTGCACCTTGGGCATACGCGACATACCGCCAACAAGGATGACCTCGTTGATCTCACTCTTGTCCAGGCCAGCG
TCCTTGACGCACTTCTTGCACGGGCCCATGGTGCGCTCGATCAGCTTGCCGACCAGCTGCTCGAAGGTGGCGCGCGTGATCTTCATGTTCAAGTGCTTGG
GGCCGGTGGCGTCGGCCGTGATGAAGGGCAGGCTGATGTCAGTCTGGGCCAGACCGTCGAGCTCGCGCTTGGCCTTCTCCGCGGCCTCACGCAGACGCTG
CATGGCGAGGTTGTCGCCCGACAGGTCGATGCTGGACTCCTTCTTGAACTCGTCCACGAGGTAACGCAGGAGCTCCTCGTCGAAGTCCTCGCCGCCGAGC
AGCGTGTCGCCGTTGGTGGACTTGACCTCGAACACGCCGCCCGAGATCTCCAGGATCGACACATCGAAGGTACCGCCACCCAGGTCGAAGACGGCGATGA
CCTTGCCGTCGGCCTTGTCCATGCCGTAGGCCAGGGCAGCGGCCGTGGGCTCATTGATGATACGGAGCACGTCCAGACCGGCGATCTTGCCGGCGTCCTT
GGTGGCCTGACGCTGCGAGTCGTTGAAGTAGGCCGGCACGGTGACGACGGCCTGGGTGATGGGCTTGCCCAGGAAGCCGTCGGCGGTCTCCTTCATCTTG
GTGAGTACCATGGAGCCGATCTGCGAGGGCGAGTACTTCTTGCCCTTGGCCTCGACCCACGCGTCCTTGCCGTTGTTGCCCTTGACGATCTTGTACGAGA
CCACCTTGGACACCTCCTGCGTCTCCTTGTCCTCGAACTTGCGGCCAATCAGGCGCTTGACGGCGTAGAACGTGTTCTCCGGGTTCGTCACGGCCTGGCG
CTTAGCGGGCATACCCACGAGGCGCTCGTCGTTGTCCAGAATGGCCACGACCGACGGCGTCGTGCGCGCGCCCTCTGAGTTCTCGATCACACGCGCGGCT
TTGCCCTCCATGACGGCCACGCACGAGTTGGTCGTGCCCAGGTCGATGCCGATGACCTCGGAGCCGGCGGCGGCCGAGAACATGCGCTTGGCAGCCGCCG
TGGGGGCGGGAGAGCGGGCGGCGGCGAGA