Description :
From Genome Similarity Track
Location :
Scaffold_31:160435- 164564
Sequence
4129 bases(100 bases per row)
GAGCCTAGACGAAATACTCTGGTATGATCATATCACGGATTTTCAAATCCACTACCTCCCGAGATGGTGGATTTGAAGGGCTCGAAATACAGTGGTACTT
CGGGGAAATACAGTGGTACCTAGGGGCAATTCGGGAGGTATTTCGCAAAATCCCGCATTTTCGTTGATGTTGAAACCCCCTATTCAGTATATTTCAGTTC
GCAGGCTTCAGTTACCGGCTTCAGTTTACCGGAGCCAGTTGCCGGGCAGCACTCCCTCCGGGGTTACTGCTATCCCAGAATAAATATCCTGCTCAACCAG
TTCGCCACTCCACCGAAAAGCCTCTACTTTTACGTGAATTTCAAGAAACCATCCGATTTCGGAAATTATTAAACGATTTCACTTGATTTGAGTATACTTT
CTCGATTAGAGGACGCCGAGTAAATTTTAGAGAATTGCTTCGAAGGTTCGCACCAATACTTTCCAACATGGGTGCATCGGTCCGCATGCTATTTCTCCGC
CTTCGGTCCAATCTTCATCCTCGTACATGTTATAGTTGCTCAAGTACGCCTCGTGCCGCGGAAGCTACAGTTGTATCTCTTCATCGGAGCTCGATGGTCT
ACCTTCCCGGCACATCCGCCCGTGGTGGTGTGTCTTCAACGCAGCAGCGGACCCTGGACATGCTCAACACAGGACGTGGTTATCTTGCTTCTCCTCCTCC
TCCAAGACACTCATAATGTCCCCTCCGCAGCGCTGCACGTACTCGCCGTTCGCATTTATACAAATGCACTCTTTGTTTGGTTCCGCAATGAGTGGACTGG
CTCCTTTAGAGAACGCATGCAATTAGTGTGGGTTGGTGGCGCCTCAGGAGGAAGGCAAAACTAGTATGGTCACATAGTGTGGTCCGTACTAACCCCAAGA
CCATCGCATTGGTTCGTATCGCATTGGTTCGTCTGAAAGAATTGGCGCCGTTCCCATGTACGACTGACAAGCTGGCCAAGTCGAGATGCCAAGAAGTTTT
GTCTAGGCTTAGGTAGAGCCGCTAAATCAGGGTGCCTGGAGGTACGCTCAAACTCACATCGATAAGCTTTTGGGTAAGAAGCAGCCCCTCGAGTACATTA
GCCGTGGGGGGTTAAAGGCTTCCGCTATCCGTTTGCCCTGCACTTGCAGCAGCAGCAGCAGCTTAAAATGGTTTTGAACGAAGTGTTTAGGCTGCACAAG
TAAGTTCTAGGCCGTGCAACACGCTGCAAAATCGCAAGTAGGCGTTCAATGCTCGTCACGAAAAAGATCAACGGTCATTCAGTTTCATCTTCTTTAAGCA
GTTTACACGAATTAATAGATATTTGTCTAAGACAGCAATGCTGATGGAGTGAGTACATGTAGCGAGATCGGTTGACGACCACAATTCATTGCTTTTTCCA
GGTACATCGTATCGTTGTGAAGCAAAACCAATAGGGTTGGAATGAGCTCGAGCTCCAAAGCAAACAGAGTTTGGGCAAACATTTAAAAACTAAATGTTCG
AGTACATTTATAAAAAATAGATGTCCGGTCTTGTATTTGATACAGGACTTCTATTTTCAGGCACTCCAACCTATTCCTGACCCGACTTCTATTTGCTACA
GGTCTTGTATTCGGGAAAATCCGCTAGTTACGCACCCACACTACCGGAAAAATTGTACTTAAGTATCCCAATTTTCTAATAAACATGCACATGGCTGTAT
CGTTTCTTGTTAACACAGATCAGAATAATGTAGGATTTGTATTGACAGAAAGCAGTGGGACGGGTGTGATGGGCTCATCTGGTCGTGTTGTGAAAGCACG
TTGCCATAGCAAGCAAACCTGCGCGGAGTGCCCATATAGCAGGTCTGCGCGATTTTACGGAGGTAGGTCCTGCACCAGGCATTCCAGCGGATGGACCCGT
TGCTGCAACTCGGTGCTAGTTTTCTAATTGCGGGGGGTCTACACTGCAGCACCGCAGATTCACCCCCTCTCTTTGCGGAGCGCAGCGGAGCAAAGCCATT
TCACGCGGATGACATCCGTCCTGCGGGAAGATCGTCACATTGGTGGGTGATGGGCTGCCTTTACAAGATATACCGAAAATAGGCTGTGTACGTAAGTCCT
GCCGAGACGAATTACTCTAGCCTGCCCGCACCCCCCAGATGACAAGCCCTATGATCGAGAGCTCAGATTGAGCTGAAATTTGGCACATAGTGTGCTGACA
GCATAAAAATATGTACTGTGAAGTTTCGCCTTCGTAGCGCAAGTAGAAGGTATGAATGGGCAAGGAAGTACGAAATCTGCCGAAATGTGTAAATGAAATG
TGCCTTTTCTGTCCATTATGGCTACATTATAGTTTGTTTTATGCCCACAATGGACGGGTTATGGTCAAAATGTCATACATTGATTGCGATACCCCTCGAC
GAAGGGCCTCATTGACGAGACACATATCAGGTCTCGCCTCTTTGATCCATCGTATCTCATCCATTTTCAGTGCTGCGAGTCTACAAAGGCTGCATCTACC
ATTTCTTGATCGGGTCTTTCCTTTGAACTCTAAGCTAGACCAATTTAGGTTGATTTAAAAATGTTGGAAATTTACACTTGCCATCCAAAAAGTGCGAAAA
GGTGCGGGTTGTTACAGAGACAGGGTGTTAAGTAGCTAACGCCCATATGTAAAATGGTGAGGAGATTGTTGAGCTACTTATAAGTAGGTCAGGCCATCAC
ACACAGCGAGCGAAGCGAGCTCCCCGCCTGCGGTTTGTCAGCCCGTGTGCGAAGCACGCGGATGCAAACCCAGGACCCAGCACTGCCCTTCTAGCAAGCG
GAGGCGACGCGTGCGAGCCGAAGCGGGCTTTTTAGGGTTCTGTCCAAGCGAGCGTAGCGAGCCTTTAGGGTGGAAGGTCCGCGCGGAGCGCGTAGCATGG
TGATAGTTTAACTAACTAACTCATGTGTCCTAATCTACTTACATAGCTGCCGAAACCTACTTAGGTTTTTTGAAAATTTGAAGTAACTACTTGGCTAGAG
TAATTCCTCTCCTGCCGACAATGCCCGCCGGCGGCGGAGCCAGCCCGAAAAAAATAGGGGGCATCCCAAAAACAGAGGGGCAAGAGGACCAAAATCGGGA
AATTTTCTCCAAAAAACGGGAGGGCATGCCCCCCCCATTTTGACCGTGGCTCCGCCCCGTTGCTGCCTCCAAGTGCAGCACGAGAAACCCAGTCTACCGT
AGGTAGGTACAGTAGACTACCGATAGATTGGAGCCTACGTTCTCAGACTTACAGTGGTACAGTAAGATCAGAGCGCGGGAAGCGCTCGATTGTGACCGCA
TGGAGCACTGTATCATTCCAGATTCTGCGGGGCTGAGGAGAAGTCGACGATGGAGCGAAAAAGATATTTCCGGCTGGTTGATGGAGCGCGTCGCCCTCAA
CCTGAGCTTGGGGATGTACCAGTGCGATACGTTCGTGTTCGTGACGGCACTGACGCCGGGGACTTTTGCGAGACGGTGCTGGCACGCTGCACAGACTCGC
TTCCACCAGGTCTAATCGACGAGGCAGTCCTCAAAGTGTTCGTGAACAGCGAAGCTGCGGGGCCTCTGAACGCGGACGATGCACTGAGCGCTTATGGACT
GAACAGAGAAGACCCGCTCGTTGTGGAAGTGCCGAAGGTCTGGTTTCACTTGACGGATGCCGGTACCCAGCCCCCATTCGCAAGAACAAGTGCAGCCTCA
GTGCCCCTGACTGCAAATCACACCATCGAGAGTCTGCGGAATGCAGTGATGAAGATGTACAGCTCAAGTCGCCTTGCTCGGGTTGCTGTGTCCGACCTCC
AAGTAATCGACAGCGAGATGTAGGGGCCTTTGGATCTCGAGATGCCGATTGGATCGCTTGGTCGGACGCTGGCGACTGCGCTCATCATCGAAGTGCCACA
AAACGTGGGTGAGCTGTACCGCCTCAGTATCGACCAAGAGCATACTTCTTCCGTCCAAACCTACCAAAACACTGCGCAGCTTCTCAAGGAATCGCTCGAA
GTGAAGGCCGTGGTGAAACTTATCGAGAACGCGAGTGAATCTCCAAGTCCAACGCGGTTTGTTGTGCTGGAAAACTCGTCGGGCACCGGCAAGACGCAGA
TGGCGTTCAATCTGCAGGCCACAGAGGCT