Description :
From Genome Similarity Track
Location :
contig_57:160355- 164033
Transcript NameFunction/comments
g10507.t1hypothetical protein
g10508.t1RAW41200.1 hypothetical protein PC110_g2581 [Phytophthora cactorum

Sequence
3678 bases(100 bases per row)
ACGTCTTGCCGGTGGTCTCCATGGTTGACTTGAACTTGAGATCTCGGATCCAGAGTGGATCGCTTATTGTGTTCTTGGGTTTCAGGCTTGAGTCTTCGGT
CTTGAGGCTTGAGTTCTGCGGTGGTCTTTGGAGAATGCCAGCCAGGTCGGCACTGTCGGGTGTGATCATTTCCGCATTGGTGTACACAAACCGTACACAA
ACTGCATCCGAAACCCCGCGTAAACCGATAGATGACACATAAACGGGTCATATGTTTCGGCCTACTCTGTGGACAAAACTGTGGACACCGTCGCTGGCCG
CTCGTCGTCGCGGCGAGGAAGCACAGCTTAGTGGAGGTGGCAAATTTATTCTTGCAGAAGCGCTGCGGCGCTCTGTTGGAGACCTGCACCACGCGTATTG
ATTGACAAGCGAGCTGCAGCCGTATCTCAGGATCGGTACGTAAACCCTGCGTCACAAATGGACACTTTTGTGTCCATCTGTGGGAGGTTTTACTGTCGAG
GTTTTTCAGTGTAATTGCTTTCGCCGTCCACTTCAACTTCCAATCCAAGCGCGGCAACTACATGCACAGGTAGCACGACAAAGGCCCTGGTGAACAATAC
TGGTGAGCACTAATCAAACAGGTCCCGTTGGCGACTGCGGCAGAAGAATAGCCAGCTGGCAAGGCTCAGCATCACATCGAATTAACACCGCTTGGCTCCG
TCAAGGAGTGAAAGCTCGGTGTAGCTACAACTGAGCAGAGAGGGTCCATCCAGCACCAGCAAAGTTATAGCTTCGCGCCAATATAACCCATGCTACCAGG
CAGTTTGCGAGTGACGGTGGCCTCGATCCATTCTCGCAAAAAGCAACCGGTTGTCGTGCAACTTAAATCTGTGGCAACTTAACGAGCGGTACAGCGTACC
GTATCTTTCGCCAGTTTCCGCCAATCAGCGTACTTAACCTAAACCTGTCGTGAAATGATCGCTCCGTAAAACTGCCCGAGCAATAGTGGAACAGCGCTGC
GGAGCTGGAACCCCGAGCAGCACGTGACGATGGCCAAGAAGGAGTTCCACAAGGTCTACAATGCGCAGGCACGGCATAGCCGCCTGCCCACGCAGACGCA
GATCCTCGTGGGCACGATGGGGTTGGCGGCGTTGCTGCTGGTGATGGAGCTGTCAATGCTGCGGGGAAGCGGCATCGTGCCGGCCGACTACCTGCACGCG
GAGACGGAGGAGGGCGAGAGCTTTTACCCAGACGAGATCCTCGAGTCTAAGTGGGCGGACGAGGTGGATGAGGCCGATCTGGTGCACCTCAGTCTGCTGC
ACGAGGCCTGCCTCACCTACAAGGACAGCGTCGTGCCGTGGACGTATGGGCTGAAGGGTAAAGTGTCCAAGCCCAGCGTCCTCATCGACAGGGACGACCC
AAATCTGCTGGAGAAGATGCGACAGTGTCCAGATGTGGACATTTTCCTGCCGCTAGGCATCCGGGGTCATGGATACTGTGAAGATTCCATTGCGTACACG
AAATGTACGTTGTTAAAATCTAACATTTAATGCGCTTATGAGACTGGGGGGCTGTGGAGACTGATGAAGATATGTTGTGTTGCTGTTTTTGCAGTTTTGG
AGTCCCGACTGCTGCCGGCGTGGGCGATTGAGATGAAGTATGTGGACAAGGAAACGGGCGAGACGCTCTCGTACCACGACTTGTGTCCAAAGACGCCCAT
GATCTTCCTAAACCACTACTGGGACGGCATCCCGGACTCGCCTGACTGGCCAGCAAGCAAACCCATGTACCTCATGCCGAATATCGAAATGTACGAGCTC
AAGGCAGAACATTACTGGGGGGTGGACGTGGTGCTCTGCAAGACAGCGATCTGTGCGCGTGCGTGCGGCTCTGGTACCAGCAGGAAGGTAACCCTCGTCA
CACGAAGGTACTCTACACGCGGCATACGTCGTCGGACGTCGCTATGCTGGCTAGAAACCGTTTGGGGGACGACGCGATCAAGCCGAAGAATTGGTCGGAC
GTGCAGTTCATCCATGCGGTCGGCACCAGCGTGCAGAAGGGAACTAGACCCGTGCTTAATTGCTGGATTGGACGTCCTGACTTCCCCCCGCTGCATGTGT
ACATGCATGAAGACGTGTACAGTGGAAACCTCAAGAGCCACTACGAAAACAAGATTAAGGACACACAGGTGCACATGCACGTCGGCCGCGCCAGTGCTGA
CGACTTTGGCAAGATGATTGCCGAATCTGCATTCTTCATGTGCACGAGTCTGCAGGAGGGCTATGGCCACTACATCAACCAGGCACGCGCTAGCGGTGCT
GTGATCGTGTCCACCGACCTGCCGCCCATGAACGAGTTCTTGACTCCCGAGTCGGGTGTGCTGATCCCTGTGGAGCGCTGGGCCTATCAGGAGCAGATGC
TGGGCGGGAAATACAACGGAGAGCACGGCCTGAAGGGCGTAGAGGGGTTCACGGCCGACCTAGACGGCCCTGGAGTGTGCAAGGCCGTGGAGAAGGTGCT
GTCCATGACCCCAGTAGAGCGTGAGGCGATGGCGGCGCGAGCCAGGAAGCAGTACTTCATCGACCTGAATTTCTTCGCGTCCAAAATGAAGGAGCTGCGG
GAAATTGCTCGCGGTGGGGAAGCGCCACGGCTTCGCTCGGAGGAGGACACCGTGTAGTGTACCATGCAGATAATGTCGGTTGTAAGAATCCCGCATACGC
AATGGCGGAAGGGTCTTGCGGCGCGGAGAATTAGGTAGAGGGTAAGAGAATGCTGCAAGCAAGAACTCGTGTATCTACTGGGCTACGTCGTCCCTTGTTT
CTGACAGGCTTCGCTCGCGCTGAGAGTGAAGTTATCTGCTGTCCCCCAATCGATCGATAGCTACCGAGTCACCAAGTTGAAGCCAATACAGCTGTTGGGC
GAGATGGATACTAAAGTGTCCATTTGAGGATCTAGAACAACGCCCTGGTCGTCGTCTACATGTGGCAGACCAATATAATTTACAGCGAGCTCTGCTGTAT
AGCTGCCGCATGCTGCTTCACCCGAGATCTTGCACGATAGAAAGCTGCTACATGTACGATAGCAATGGCGAGCGTCGAGCGTCGTCAAAGTGACAATGTA
ATGATATACCTGTGTGCCACATCATATATATACTTGAAGTACAATATTACATGCACGTACTCCACCGGCTTGTTTGCAGCCCCAGACCAGGACGCCATTC
CACTTGGCGCTTCGACTGCGACTGCGACTGCGCCGTTCCTGGCTCGTGGTCGTTTTAGGCCTGGGAGTTTTCGCTTTAGCTGTCGCCGAACGGATAGTGA
CATGTTTTTTTTGCAAGGGGGCCAGTTCTTTTCGCCACGTCGCTCCACCCAGCTGGCGGGCGCAGCCAAACTCATTTGGATTGAATATCCGACTCTCGAA
AGCGGTGGTTAACAATGCCAGCGAGCGCAGTTTTCTCGAGGCTAGTGTCGCCGGCGGCACTGGGACTAATGGTGCCCATGCATGGATGCAGCATAAGCTC
ACTGCAGCAACAGCATCGATAACCGGCGTCCAGTTTCGTTCGAGGCGAGTTGCCCTACCCCTCGGCACCGGGCACTTCTAGGAATCGTCGTGTTGCCGTT
GGCCATACAAAAGGCAAGTCACTCGGACGAGTCGGCGCCGCGTGTCCGGATCAAATCGCTCCGGGGCCGCTCGTTCTG