Description :
From Genome Similarity Track
Location :
Scaffold_269:16033- 38049
Transcript NameFunction/comments
Phyke_g8878protein pelota
Phyke_g8879hypothetical protein
Phyke_g8880hypothetical protein PHYSODRAFT_566404
Phyke_g8881notchless family protein
Phyke_g8882hypothetical protein

Sequence
22016 bases(100 bases per row)
GgcccaagatgaagctgctgaagaaacaGGTCAACGAGAAGGATGGCGCCGGCTCTGTGGTGCTGCGTGCCGAGGAGCCCGAGGACATGTGGCACATCTA
TAACCTCATCCACGTGTCAGATTCAGTCAAGACCACGACAATCCGCAAGGTATTTGCTGCTTAGTAACGATGATCTTGTATGTCGTACTTAAGTGAATCA
GCTGCTTGTTATGGCATCTTTAGGTGGTGAAAGAAGGTGTAACGGGATCCACCAGTAGCCAACGTGTGCGCATGACGCTGCAAATTGAGGTATGCTGTTA
TATGCATTGCTATGTTCTTGTGAAGTGGACTTCTAACGACTGTgagcaggtggagcaggtgaaCTTCGACCCGGCGCTTTGTGTGCTGCGTATCAAGGGC
AAGAACGTGATGGAGAGTCAATACGTTCGGGTATGGTTTTTATAATGTTAATTGTGACAAAAAGTTGCAAGTATTTGGCTCACAAAATGAGGCTGTGTGC
AGATGGGAGCGTATCACACGCTAGATCTGGAGATGAATCGCGACTTCACACTGACGAAGAACTGCTGGGACGTCATGTCGCTGGAACGGATTGAGGCGGC
GTGTGATATCACCAAGCAAGCTGAACTGGCTGCTGTAGTGATGCAGGTGGGTCTGGCGCACTTGTGTTTGATTAAGGGAGACATGACAGTGATTCGCGCC
AAGATCGAGACGAGTGTGCCCAAGAAGCGTCCGGGGAATTCAGCACACGCCAAGGGCACGGAGAAATTTTACGAGAACATCGTGCGCTCTGTACGACAGC
ACATTGATTTCAAGCTTGTAAAAtgcgtgctgcttgccagTCCGGGTTTTGTCAAAGACGACTTTTACAAGTTCATGGTTGAACAAGCTGTCCGTCAGGA
TGACAAGCTCATTTTGGAGAACAAGTCGAAGTTTGTGCTATGTCACTCGTCATCTGGACACAAGCATGCTCTTGATGAAGTGCTGAATGACCCAGCCATT
CAGTCTCAAGTGGCAAATACGAAGGCCGTGGAAGACGTCAAGTGCCTGGAGCGTTTTTTCAGTATGTTGCACATCGATCAGGATCGCGCATACTATGGCC
TCAAGCACGTTGATCGTGCCAATGCGAACATGGCAATCGAGACGCTAATGATCACGGATGCGCTTTTCCGGTCGCAAGATATTGCTTCGCGTCGCAAGTA
CGTCGACTTGGTGGAAAGCGTGCGCGACAATGGTGGTACGGTACGGCTGTTTAGTAGTCTGCACGTTTCAGGTGAGAAACTCGGTCAAGTGAGTGGTGTC
GCCGCTATCCTGCGATTTCCTATGCCCGAAATCGACGAAGAGGATCAAGACGAAGGTTCCGACTCGGATTCCGAAGATGACAAGGAAGACGAAAGCGGTG
TGGGCGATCTGTCTGTTGAGGCTTTGGGTATGTAGGGAAGACAGAGGTCCCCCGCATAACAAAACAACACCACGAATACAGCAAAAGATAAACTCATTCC
GTTTAGGCGCCTGTGTTGTGCTGTACGACGAGGTTCGACACTCGCTTGTCGAAGGTCTGCGACGTGAGACGTTCACCGATCGGTGCAAACGGGTTTGACA
TGGCGTTCACATACAGACGATGCACCTCTGCGAAGAACTTCAGCAAGAAAACACACAAACACGTAAATGCGTCAGTGCAATTCTGGAGTCGTTTTAATAA
AGGCAGCAGGACATGGACGCAAGGTCTCACTGGTCTCAGCTCCGACTCGCGCACAGGAGcgtcctgcagcaccaccacgaacttAACGGACGTGTTGGTA
ACGTAGCCATACACTCGGTAGTCCTCAACCGGCCCCAAAAAGCCCAGATACATGTCGTccttggagctggagatgccTGCGCCTCGAAGTTTCTCTTCGA
TGACGTCCAGCGACACGTGCGCGATGTAGTGAAAGCCCAagtcttcaccttcttcaccgaACGTGCGGATGTACAGGGGGCTGTTCTAAATAATTAGGTA
AATAGGTTAGTTGATAAGAGTCTGTTATGGGCTGGAAGCTGCGAGCGCACTCACCGCCGCGCCGATGACAGCGACACATGCGATCATTTTCCTGCTAAAC
AAACTTTGTATGGAGTTGATCTGAGTCTACTTCTGATTCTATCAATGGGTACATTGTACCAAATTGACATGGACGTATTCGGTGGACGATCACCATGAAG
GGTCCTCTTCATCTCTAACTGTTTCTGAGTCACGAGCTGTCGATGGTGGGGTGTAATCAGGAGTGTAATCACCCACGATGCCATCTTCTTCGAACTCTCC
AAGTGAGTTGTGATCACTTGAAGCATAATGGGGATCTGTCCCTACAACATtggcatcaccagcatctgACGGAGCAGATTTTTCTTCACGAGTATTCGAC
GTTTCATGCATAACTGCAGAGTCCTCCTGCTCTTTTGGTGATGCTGGTACGGGTACGTCTatgttgtcgtcgtcgattGGAGGGTCATCTTCAATCGTGC
GAGGCATTGTGATgcctccatcgtcgtcttggGGGATCTCCACATCATCAATGTATGCCATATCGCCTAGATCCGGACTGCTAAAATCCGACGAGTGTGG
GTTTAAGTTCCAGCTTGCTCTCTCCTGAGGCTCAAGGACTCTTGCTGGTGAAGTCGGATCCAAATTCCAAGCCCCTGTTGTATTCCCCTCACCACGGGTG
CTGTCTGAAACAAGCTCTGTAGGGTGATCATTAATGGAGACTGGTGGAGGATCGTTGGCAATTGACTGAGGTGGCGTATAATTGTTGGGGTTCCGAACCG
TACCTTCATCGATATTGCCATCGTTGCCGGACTCTTTTGACAGAGCTGGCGGGTTTGGATCCACGTTCCAGGCTGCATCTGGATTGTCGTCACTGACATC
TCCTCCATGCCCAACAGCGACTCCTGTAATTGCAGATGATGGGCCGGGGCTCAGCTCAGAAGAAGGATTTGGGTCCAAGTTCCAAACTACCCTCTCCTCG
ACACCGTGTATCGCGTCCTCGTCATAAGTAACAGGCGGGGTTGGATCTGGATCCAAGTTCCAAACTACTCTCTCATCAACGCTGTGTGACGCGTCAGTAT
TGGGCATATATGGCTGTGGGGCAGGATTAGGCTTCGGGTCTACATTCCAAGccttcctgctgctggtgacaTCATCTCGGGCATCGTCAACTTGggcatc
gtcttcttgtACAAACGCACTGCGCTCTACTCTTTCGCCGTTCACTGAACCGGTAATGACAGGTCCGTcacttgttggtgcaggGATCGGATCCAAGTTC
CACGCTTTACTCTCAGCGTTTTCCTCGTTCGGTGCATTGCCTGCTGGTAGCAATGCAAGTGAGTCACTGGCAATTGTTTCTTTCTCGTTGTTAACAACTA
ATGCGTCTAGCGAGGTAGCTGAGTTAACCTCTTCGGGTACGTCAGGGTGTAGGTCCACATTCCAAGTTTCTCTTCGGGTATCACTTTCTTCGTCATGCTC
CTGTTCAACCGTAGGAGTTAACGGATTGGGGTCAACATTCCACACTGCAGTTCTCCCACTGCTTTCGGCATCATTGCCAGCGCTAACCTGTAGATCATGT
TGACCGGATCTActttcctcctccttgtcaTGGAGATTGATGCCACCTGGGGCCGGATCCAAATTCCAAACGCTTCGTTCTTTGTCGTCGGGTTTTGTGG
TCACGGAATCACTAATtgcatcgtcatcgctgccatcaaattcctcctcctcgtactgttgttgctttccaCGTGACTTATCACTGTCTTCGTGACCTTC
CACACTATTTTGATGTCGAactccttgagcgtctgtGGCTTCATCTGTATGATCATCCGCAACGTCTTCGTCTGGGTTGCTTGCGGTTTTGTTTTCGGTA
TTTTGTGGCGTTCCCGGGACCGTGTACACTTGGTTCGTCTCAGTCTGGTCATGGGTTTGACTTAATTCAGATGCAGTTGCTTCGCGGTCAGTACTGACTC
CGGCATTCTGCTGCGCACTAtattttgctgcttgagtaTCAACACCAGCATTCTGTAACGTAATACCTTCAGCTTCGCGAGCACTCACCGAACTGTCATC
ATCTTTTTGCGCAACAGCACTTTGTACCGCATCCAGTGTTTCAAGGGTAGTGTTGATCCGTGTCGAGACATCACAGGCGGTGTCATGATGCGACCTGTTC
GTATCATCGATGCTTTCAACGCTAATAGACTCACGATTTTCTGCTGCCAAAGTCAATGCTGCTTGAAGAGCGCTGGCAGCCTCCTCACTCAGTGCTGCTT
GTCTCTCGCTTTGCTCTGCAAGCTGAATTTTCTTCgcttctcgagctgctcgaatATGCAGATTCTCTTCTAGCTCAcactccacctccagctgtGCCAG
ACGAACTTGCTTGTAAtgttcagcttcaagtgctcGTCGACGTGTTTTCGACACAAAGCCTTCTCGATGATCATATTTGCTGAGTGGAATCACCCGCACT
TGGCCGATGCCGTGAGCGCTCAGCGAGGGGAGAGTTCGACTGGGACTCAACTTGATGGGGTCACTTCCGCTCAATTTACTTTCTAGGCGTCGGTCATAAG
TCACATCTGGAGATACCGGCTTGACTTTTTTTGCCGGGCTTCCAATAGTACTGGGTACGCTAGAAACTTTCATCTTGCCTATAATCATAGGGGAGGTTGC
TGCGGAAGTCTCCAATTTTGTGCGAAGACGCTTTATCTCAAGATGACATTCTTCAATCTCTACCTCCAGTTCCTGAAAGCGAAGGAATTTGCTACAATCC
AATTTAGCAACAAGCCACACAACATTAAGGGCAACATGACATGTCAGCAATAATTACCTGCTGTACTTCAGACGGTTAAGCTCTCGCCCACGCTCTTCAG
CGAGTGCCTCAGCGTTCACTGCCTGCCTAACCGACGAAGGCAGCAGTCCACACAGTGTCATACACGTTAGCATGTTCATCAAGCACTTAAAATCTAGTGA
ATACCATACCCGTTGGGTGCTCTCAGTGACGAGTCGATCCATGAGTTCATGCTTCCGCGTTTTGGTGGTCTTAGCATCCTGGGGCGATCGTAAAATCGCA
AACGCAGCTTGCAACTACAAGAAGGGATTTTAAAAATGCAAGTCAGAGGAAATAGTCATGAAGCGCACGATGATGGTAGTGCAGGGTAAAGTGTCGTACa
tccttttccttcttccGTAGTGTTTCCTGCAACCTCCGAGACGCAGTCTTCAATTGTAGCACCAGTTCGTCCTATGCGTGCATACAATGTCATGCGTAAT
TACATTCCAAAATTGTATTGTCAATATCCTTTAAACAAACCTTCTCTATCAGCTGCCTCTtgaccagcaccaactcctGCTTGGTGTTTTCCCATTCGCG
CCACCCGTCGTCCACCTATAACGAAAGGGAAGAATTAATCCATTTCGATGCAATGCAATAAGATACTACGGACACTACCTCAATTTGCTGATATGGCGTC
ACCTGTGACTGGCTAGCACTGCCTCCACGCTTGCTCATAAGCCGCCTCGCCATCTAGGAGATGATAAATTACGCGTGCATACGCTCACGTCGTTTCAGGT
CGatatgtagccatttctaCCTGAAAGCTATGTAATTTCTATTAAGTTAGAAATGGATACATCGAACCGAAACGACGCGATCCAGATTGATACAAGCAGT
CGATATACGCTAGCAGCATGGGTGAAGCACCGAGCTGGCAGCACATGTGGGGCGCCAAGGTCAGGATGCCCTGTGATATGGAAGATGACGTGCTGGAAGA
CGCGATCAAGCATGTGACATCGCGCCTGACCAAGTACGACACGGAGGAATGGGAGAAAAACGGGCTGGCGGTGGGGCAGTAGATGTGGAGAAGTTATCGA
TTACTTGGCAAAGGAAATGTTGGCTAATCTACTACTTGCTGTATGTGATCGGTAGGTGTGTGAAGACATCAAAGCCCATCTGGACGAAGCGTGGGATCCA
CACTGGGTAGTGTGCATTGGTCGGAACTTTGGCTCATTCGTGACGCACGTAACATGCAATTTTGTGTTCTTCTACTACAACGAGAAAGCGGTGATGATCT
ACAAGGCAGGGTAGCAATCGTTTGAATGGCATAGTATGCAGTGCGCATGTACACGAATATACGAGCCGAGTATAATGATTTTGCTGGCCATTCTGCAGTT
AGTTTGAACCCAAATAGAAATGATTTTGGGTGTGCCACATCATTTTATTGCGAACCAACAGTTTTTGACACAAAAGCCATCTTGCAGTCATGGCCACGCA
CGCAGAGCCGagtgccaagaagatgaagctggaacACGAGCCCAATAACACAGATTCAGACAACTACATGAAGTCAAAACCCAAtgtcagcgacgatgaa
gactCGGAGGATGAGATGGGCACATCTGCCATTGCTCAGTTCCAGAGTGAAGACGTGAGCGACCAATTTGTTTGACAATGTTGCTACAATTATATTGATA
TGCTTGTGATGTAATTTGTGCTTTTGTAGGGAACTAATGTCGGTCCGCAACTGGAGATTCCTATGAGTTCCAATGTGCGGCAGATGGAGGTGCTAGTgaa
tgagctgctgcagaacggCAAGAATCGCGTGCCGTACTCACTGTTTATTGGAGAGACGGAGGTCACCACCTCACTCAAAGCcacggtggaggagctggtg
aGTATTGGTGCACTCTGCTCTTGAGTGATGCTTGCTTGTACTGATGTTAGTTGGTTGTACTGTAGAAATTGTCGACGGAGACTGCGTTGACGATCACGTT
CCAGCCGTTGGCGGCGTTCCGTGTTCGACCTGTAACGCGTTGCAGTGACACTTTGCAAGGTCATTCAGAAGCTATTTTGCACGTGAGCTTTAGTCCAGAT
GGTAAGAGACTCGCGAGCGGTGGCGGTGACGCCACTGTGCGCTTCTGGGACATGAACACGTGCATGCCGAAGCACACGGGTCGTGGtcacaagcaccacg
tgCTCTGCACGGCTTGGTCTCCGGATGGAACACGTTTTGCATCGGCGGATCGTAATGGTGAAATACGGCTGTGGGACCCCAACACGGGCAAGCAGATCGG
ACAACCCATGAAGGGCCACAAGCAGTGGGTTAACTCGCTGACGTGGGAGCCGATGCACCGTAATGCTACATGCGAACGCTTTGCGAGCTCGTCAAAGGAC
GGATCTATTAAGGTGTGGAATGCGCGCACTGGAAGATCGATCGCGTCGCTGTCGGGCCACACAGACTCGGTCGAGTGCATCAAGTGGGGTGGTGAAGGTT
TGCTGTACAGTGCATCTCGTGACCGCACCATCAAGGTCTGGTCGATGGAGGGTGAGCACGTAGGCAAGCTTGTGCGCACCTTGATCGGACACGGCCATCG
CATCAACACCCTGGCACTTAACGTGGACTACGTTTGCCGCTCAGGGCCATTCGGTCACGCCACCAAGAGCTTTGGATCGCGtgaggagatgcagcaagcg
gcACTGAAGCGCTACGAGGAGGTGCGGAAGGGTCAACCGGAGCGTCTAGTGTCGGGATCGGACGACTTtacgctcttcttctgggagCCTTCGGAAAACA
AGAAACCTCTGGCCCGACTCACAGGCCACCAACAGCCAGTGAACCACCTGTGCTTCTCCCCTGACGGACGGTACTTTGCCAGCGCCTCTTTCGACAAGAA
GGTAAAGATTTGGAACGGCCAAACTGGTAAGTTCCTGTCGACGCTCAATGGTCACGTCGGCGCTGTGTACCAGGTGTGCTGGTCCAGCGACTCCCGTTTG
ATTGTGACTGCCAGCAAGGACTCGACTGTGAAGATGTGGGAGCTGAGCGATcccaagaacgccaagacgacgctgtctGGCCATGCAGATGAGGTGTATG
CACTGGACTGGAGTCCCAACGGAGACATGGTGGCCTCGGGCAGCAAGGACCGCACCATCAAGATGTAAGTTACCCTTttcgcgtcgtttcgtgtCCCTGT
CACTAACTTCCCTCGTTTGTGTGTCATACAGTTGGAAGCATTAAGTTCGCAATAGAAttttgattttgttttaCTGAAAATATGTATTGTGAAATCATCT
TTGGCATAGCAAATCGAACTTACAAAATCATAATGAATTCAAGTTAAATAAACTGGCGCAAGTTTCCCGCCATCAGAGTTTGACAGTCGGTAGTAACGAA
ACAGTGCAATAGTAATAGTATATCGGATATTTTACTATTTCTCTTAGTTAGCCTCAGTCAAAACGGTACTATAGTAAAGGAGTAAAAAGTGAGTTACTAC
TGGCCGCCCCGCGCGCTATTGCTCACTTCCACATTTGCCCGCGACCTGAACCAGCTCCAAGTTCTGCAGACGATGAAGCGTGCACGTGACGAGTCGATGG
ACTGCGATGCTGAGGTGAtgacaccaccgccatcGACATTCTGGGGGTCCATCTCTCCGTGGAAGGCACCTCAGTCGTCCGTCAAGCGCCGTCGTGACCG
CTCTGTTCCAGTCGGTGGGTCAACTGCATATCAAACCCCTATAGGTTATTATTCCTAATTCTGACTGTTGATTGGCTATTAATACAGACGCTTTGAGTCG
AATGATGTCGGCGGCTGTGACCAATGCAcgcttcaagaagcacagCATGAAGAAACTCTTTGGCTCTGCATCCTGCCACTTGGTGAGCTGCGCAGTGTGT
GAAAGTGTGGGGAGACCAATCAAGCGCCAGTTCGCTGCCACGCAACAATGCTCTCACTGTGAGAGAACCATGGGGGACTGCTGTGGACGGGAATGTGACG
CCTGTGGAGACGCCTTCTGCTCGCTCTGCTCGACGCTCAATTGCGACGAACAGTTCGACCGCGTCTTCTGTCTGTCCTGCAACCAGGACAAGTCTAGAGT
CTAAGAGAGTTGTGGTGCAGCTCTGGTTCTACTGTAGAATGACTGCTTGTTGGACGGGGGGGGGCTGGAGGTTAATTAGTAATTCTAAAGTGCATGCTTG
CCTGTTTAAATGAAGTTCTCAACTGAACATCCCAGTGCCTGGTGTGTCGTAGAGGAAGCTTCGGACCATTTCATAGGAGACGGCGGGTTGGTCGTGAGGA
ACCATCTACAGAAACAGAGTAAGTCACTGATAACCGGTATGAGGATGATGATTTACTGGGACGTACATGGCCTGCTTCATACACCTTCATGAAGCTTAGT
CCGTGAGCGGTCCGCACACGCCCGATTGGGTGTCCTTCAAAGTCTTTCTCTATGAAAGGAGTCGAGCGAAACGCAGTCCCGTACTTCCACGAGAGATTGG
ACGTCCATGCGTCTTGTGACATCCAGTTTACGACGGtgtctgcagcgccaccGTACACCAACACACGAACGCCTTGATCAAGAACCTCGGCAATATAGCT
TTCGCTCTCAGAAATTCTATCCATTTTTGCAAGATTTTGGCGAGCTTCACTTGCGCACAACTTCCATTCGTGATGGCGTTCACCAAAGTAAGCGCTTACA
ATTGGACTGTTCACGAAATCCTGGAGAAGTGCGAAGCGGTAGCAAAGTTGGAGCGGGTCATCGAAATGGCATGGACGGCGCATATCGTACGAGTTCCGAC
CCAACTCCCAAATTACAGTGTCTGCTTGGGCGTAAAAATCGTTGAAGTTACGGATCGCTTCTTCGCACTCgctgttggtggtgacaACGGGCGTTTTTCG
CAAGTaacctgcttcttgctggttTGTTTcgttcctgcagcttgcaatGGACGACTTGAATCGATCAAAACTGCTTTGAATCTGCTCGGCATTCGACCCA
AGAAGATTAAGGCCGTAATCGTTGGTTTTTGAGAATGGGATCATCGAATTGGCCCAAGCTATGGTGGACACGACCCCGTTGCCAATGCCGACACCTTTTA
AAGTGGGAAGAGAACCGTTGTTGTTACCACCGGCTATCACTCTCGCTGCCAAGCCAGGGACATAGTGCCCAGCGAAACTCTCGCCGAATATGTGAAAGTC
GCTGCCTCGCAGATCTTGATGATGGATGAAAAACTGTTCAAGAAAACTGTGCATATCTTCCACTGCACCCCCAAGCGACCACGGGGGAAAGCTATCGCCG
CTGTATCCTGTACCTTTGGGTTGGTCAATATAGATGACGTGTGCAAGTCCAGTCCAGGAATATGGATTGAACGACATCTTGTTCGACTCGTCGTCGAATG
AGCACGGTCCATTTtcgaacagcaaagcaaCCAAACCAGAGCAGCCAGGACCACCAGAAAGCCACAAGATCACAGGGACATCGATACCGCGCATGGACGA
TTCGTAGAATACGTAGAACAAGCCATTCAGCGTGCCGGTCTCCTTCGTGAGGTTCTCTCCGCACAATGATACCTCAGAGGGGTATTCACTGCTGAGGTCG
CTTGCTTGGACAAACACCTGCTCTCCATGCAAGAACAGACAGAGGTTTTCCACCACTAATGCTGCCAATGCCACTGCAAATATTCCCCATgtgtgcagct
tcatcttcagtAGCGGCGCTAGGAAGATCCACCGCAAGATCGCGAGTGACGAGTGACACATAGCATGTGACCTTTGCGATGGGTCGAATGAATGGTAAAC
GAGGTGCAAATTAAAAGTAGATTGAGGTCATCATCAAACTGAGCGGGTCGTACGCGGCACCGATACCTGTCTGCGCATCCAGAGCACTATGGATGTCTTC
CGGGTGGAGTTCTCCAGGCTGTGTGAAGTGGATGTCTTGGTTCGAGCTGTCCCAAGCAGCGTTGTTGATCGGAGCTGCATCACTGGAAccgtgctgcttg
gaggGATGGTCCCAGTACGCCTGGTGTCGAAGACATACATTTCAATGTTATGAACTCCATCAATATTTACGCAGTCCTTAGAACCCACCTTGGTTGGATG
TTGCTTAGTGCTGGCATCAGCGGTGTCGAACTCCTTCTCCGCAGTGCGTAGCATTTCATGTTCATGGACGGAGGTAGACAGATTCTCCTTGCCTTTAAAT
TGATTCTGGGCAGCCGAGCTTGGTTCTTCCATGAGGGACGGTGTTTCACTGTGAACAGGTCTCACTGTTGATTGAGGAAGCACGTTTTGGCGCGGCGCGG
CTGTATCGAATCGAAAGCGAGCCCAAGAGTCCTCAGTggcaatttgctgcttgttggaTGCTTGCTGAAAACGTTTTGCTTGCCGCTGATACTGAGTCCC
TTTGAATTGACGCTTGGTTCGTGGGAGGTCCTGTTTGCCATGGTTCCCATTCTTCTTTTGATCCGCTGCTCCCTTTCCTCGGGATCTCCCCGTCAAGTTG
CTTCCAGACTTGTTTCGATGCTCTTTGAGTGGTGCTTTCTTCAGCATTAACGGCGCTGGAGCTTGTACTCGTACTGACGCTGGCACCTTCGCCACATTGT
CACGTTGATATTCAAGCCCAGAAGGACCCAGGGATGCCCAATTGAAGTCTTCTGTAGACTGTGAGTGCTTGACTTGTCTGAGATATTGGTCCatccgctg
ctgctttgcATTTGTTTGATGGGTTGTGAGTGTCTTGATGTAGCGAAGGATGCTGCTATCCTCCATTGCGTCTGAGGATCGTGCGCTCAGCTCAGGTCGT
CTAGCACCAGTCATATAGTGCAGCATCGTGTTGCGTTGTCCATTCATCGTCGCTGGGACTGGCAGAAGGTCACAATGCGGAATacagagtgatggtcaac
ttcaacttcaattgtATTTAGTATCAAAAGTAGGTGCGTTTTTAATCTATGAACCAAACCATCTCCTGGGCCCTTTGGACTTGTTTCGGCTGTagacagc
tgcagctcgccGACCTCGTCGAGAAATAGTAAGCGTCGTAAGCGAAGAGATTGGCACtgttgaagaaggaggctTCCAGGAATCCAACAATGAGTATCGT
CGCTCGGAATGCAACCCACTTTGCCGACTCATGTACGTTGAGGCATCTGACGGAGGTTGATTCGTCGCTTGCGAAAACTGTCTAGTGTCTGTTGAGGGTG
GGTAGTTGCTGTTCACGGTGCCAATGGGGGCACCACCTCCATTTTTCCGCAATCCATTCGCTGCCACATCCACAGAATCTGGCTTGGACGGCAAGCTTCC
ACGTCGGGGTCGATTGGCAAGACTCgtttcatcatcttcatgctCGTCATACTCAGCTGCCTTTCTCGAGTGATACTGGGAGTCCATCGGTTCATATCGT
GCTCCCAGTGTAGAGTAGCGCACTGACGTAGGTGAAGGCAAGGGTGAATGGCTTACAGTTTCTCCCTTGTATCGGAAGCTGCGAGGGGCAACGGCATCTG
TCACTTCGATAGCACCACTAGTAAAGTTGATGctttttggtggtgcttgcgcAACGATAGGGGCGTCAATATCGACTTCACGATCATCAACTACGCCCCC
GAGATCGATTCGAATGGAAGGTTCTCTCTCGCCGTCCACATCAAAACTTTGGGTGCTCGCTATATCTGTGTTTCCTGTTAATCTCCTCGCACCGTCCACA
TCAAAACTTTTCGCACTGAACGTATCTGGGTTTACTGAGTTCTTGCCTTTTGCATCCACCGACTTCCTCGTATCCGTTTTCCCAGAAACAATGGAGCCTC
GAATCATGGATTGCCTGCTTTCCAATGTGAAATTGTGCCATCGCCCCATGAAGCTTCGCGAGATTTGCTTTAAATGAGTTTCTTTCGGTTCTTCAGCATG
GATGATGCGTAGCACGCGGTTGACGTTGGAAAGGAGTGGTGCGTCGATCTGTTCCTTGTTTTCCACGATCCCTTCCAAAAAAGCCAGCATTTGTGGGTAA
TACTTCAGGTCCTTTAGCCAGAACGCAGGATCCTCCTTTGTCCCGCCCTCCGTGAGTGCCGTGTTGCGAGCTTCCAACACGCGCCGTAAAAGCTTCAATA
ATGACGGAATATCCGGGTGCTGCATGGTGACTCGGCAAATAAGCAACTCGATAAATTCTTTCGAGGTGATCTCAGGAAATTGAACCAGGCGCCGGGCAAC
ACGCAAAATACATCGATACGGGAAACTTGTGATCAAGTTCTGGTTGCAATGGCGAATGAGTTTCACGATCTGCTCCGGCATGCTGTTGTTTGCGATGTTC
TCGTCAATATCAAGCGATGCCCTCAAAATGTGCGAAATTGCCATAGTATACTTATCGATCTCATCTGCATTTTCCTTGAGGGTGTCGGGTGGGTTCTGTA
GATCAAAGCTCATCAGCAGATCGAGCTGTGTTCTCCATAGCTGGAATAGCAGCTCCAAGTTGTAAGCTGGATTTGTCAGCTTTTCTGGGTCTGGTCGAGA
CAGGAAGCGATCAATGTAGAGACCAGCCACAAAGTTATCGGGGTATGGAATGAAGTCGGTGTCATCATCTAGCAAAACGGAATCTCGCTTCGCAACAGAC
CGCTCCATACGATTCCTACAAATGATATCGTCGAGCTTTTTACGTACTTCTGTTCGTCTGTGTGAGTTCCAAATCAGATCGCTTTTCTCATGATTGTCGT
CGAAAAAGCGTGTGGCGTTGCTTGGATCCAAGTGGATTTGGTACACGATCGGATACGGAAGAAATCGGCAGAGGCCACTGTACATTCGTTCTCGCAGCTC
GAAGTCCTTCAATAGCATCGCGTAGATAACCTCAAATGCAGGCTCTCGTAGTGCCTCTGCTCGAAGGAAGTGTTCGTGGAGAACATGCTGTCTAGATTGA
AGTGCAATCCCTAGAATTTCAACCCATAGACCACTCACTTCCAGGTACTCTGCAATCACTAAGCACGTGTCGCACAACTCTGCCAAGCATGATAGGGCGT
AAAAAGCTTGTTCATAATCGAGATGGTCTGTGATAACCTGAAGACACCAAGTGAACTGGCAAAAAGGTGCCAGCATCCGCTCCAAGCTGCATTCAAATCC
GCAGATCTTGTTAAGGATAAGCAACGCGAGTTCCTGGCGGTTTAAATAATCCACATTCCCAAACTCAgcttccattgctgcaggGACATCCTTGACATCA
ATTTTTCTGGCTTTGTTTGCTTTGAATCCGTATGTCGAAAGCGAACGACGAGATGATATTGACACTCCTTTTGCCTTATTGTTACCATCGAATGGAAGCA
AATATCTGCCAAGAGTTGCAACCGAAATCGAGGCGTTGACCGCATCTACATCGTCAACGTGTTGTTCCAAGCACTCAATAATGGCTGGCCTAAAGGCTGG
TAAGTCGCATAGAAGACTTAGGCAATCTAGGGTGGGTAGCGTATCGGAATAAATCCCAAGCTTTGGGTCCCTATTCTCATTCAAGAACAGGAACAGAGAC
TCCACAAAATCAATGACGATTGTCGGGTACAACATATCCTCTGTGATTGCTAGAGGATTCTCCTCGGACTTCTCCAACAAAACCGACAGGTAAATCCCCC
CGACGGATGGCTCTGTCTTTAAGCAATCGTACATGTGGTTCGAGGCACTTTCCAGAAATGACAATCCGTCACCATTTGGATCAGTACAAAATTCTTCCGT
GAGCTGTGAAAGTTCGCTTCGCGTATTATCGTTCCAAATGCAGGTTGGCTCACGAATATCCGAGAGCAAGATCGTACAGAAGTCGTGTCCATTGGGCTTG
TCCAGACAATCCAGGAAGTCCATTGGCAAGAGGTTTGCCAGAGCATCAAGTCCAGCAGAACGACTGTTACTATCTGGACCAAGCGCTAGAGATCGAAGCG
CTCCAAACGCACTCTCTAGCATATCACGTTCTTGCTTCTCCAACGCAGTGGTACTTTCTTGAGTCGTGTCAATTCCAGAAGAACTTTCAGCCGAGGCCAG
AATCAAGTAGAGACCCTTCCAAAATACCCTCGATGAAGTCAtaatctgctgctggagatcacTGTTCCGGCAAAGCGACGAAGCGATTTCAAATGACATC
TTTTGAATGTGCCACGGCTGAATGTTCGTGAAGGAAAGAATTACATCGTCCAACAAAGAATACACACGTTGCGCTTGTGCAAACTTGCTCGTTCCGTTCT
GGGATAAATACTCCGTCGCAGTAAAAAAAGATgtctcgtcatcatcacccaAAGCATCGAAATCAAATGCCTTCGACGATGGCACTCCGTTAGTCGCATC
AACATCGCTTCCCATGAGTGATTGCACGCCTTCTTCGGATGAGAGGAGCATCTTGAGAATAGAGAACATGGTCTCTTTCGATGCTACGTCGTGTCCGTAC
GCACAGCTTTCAACCAAGTCAAGAACCACATCCCAGCTTCCACTGACTGTAAGCAAAAGAGGGCCATTTTGAGGCGCAATGGAAAGCAGTTGGTGCAGTA
TCTTCATTGCAAGGCCACAGAATTTAGAATCCTCAGCTTGCTCGTTTTTCGTCAATGATCCCGACGACAGCACACGGATAAGAAGGTCTAGCGTCGAGGA
TTCGAAAGAGAAAAACTGGGAGCTTGACTTGTTCAGCAATTGCACCTGGGCTTTCAAAATACActcgacaacttcatctGACGTTTTCCCACCACCAACC
ATGTCTTTCCGCTCCAGTACCCCGCACAAAGAGTCAAATGCATGGCGTACTGTTGTCACTTCCACATTTTGCTGGCATAGTTCGCGGTAGCGATCCCGCA
AATTAGCTGATGTGAACGTAAAGCTGTCGTTCCAGCCAAAAACTTTGTACGCATCCGAATAATCCATGTCTTTCTCCATACCATTTACTTGACGTCGTAC
CAAGTATCGCCATTTCTCCTCGATACTCTTCATCAAAAAGACAGGAtcatccacttcttcaaaATCGGAGTTTGAATGGTTGAGCGTCGAGAGATAGAAA
CCACTGATATAAACATCTCCAGATAACTCCAGATAAGAAATCGGAGGGATCGAGGTGTAAATGTACGTCGTAGCAACGCTATTCCTCAAGTTCTCCTTGA
ACTCCCTCAGGTGTTCATTCAGCATATCTTGTAGGTGAATTCTCATCGATGACGACCATAGCACGCGTTTGTCGGTCTTATGTCCGCTATACACTTCGGC
AAATTGTTCCGAAGACTCGGAGTCTAAAACTCCGATCAGAGACTCTGGAAGCATGTCCATCAAATAGCTTTGGCCATTGGTCCGCTCTGACGATCGTTGA
ATGCGGTGAATTCGCTTCAGTAGTGTGGCCTCCGGCACAAAAACAGGTACTTTATCTGCTCTTTTAACGGGCACACCAGTAGATAGGATAAAGTAGAAAG
CACCATACTGGTACAATTCTTGTAATTCAGTGTCGCTTAGAGATAGCAGCATCTCGCAAACATATCTCCGTACGTACGGGTCATTCACTAGTAACAATTG
CACCAGCAACGCTAAGGAGGACGTATTCGTCACCAACGTATTCACTAAAGGTGGTGGCCAGACATTCTTACTTCCAAAGGATGCTGTCAGTTGGTCTTTG
ATCATGAAGTTTCTTAGTGTTTGCAAGGCGGATGTCGCACAGACCGGGTCAATCGGTTCATCTGTCAGCTCCATCCAGCGCAATTCTGGGTACTGAAACA
TCGATTTCCACACGTGTTCATCATTCCCTGAGCGCTGGTgcatcgagcagcagcaaacatAAAGGGCATCAATCTGGTTCTGTCTGATGAATGCATTGGC
ATCCAGATACTCCTTAAGCCCATTTGCAGAAAATGGACCTCCAACTTCCGAatttgcttcagcttcctcaacAGCATCAAGCTTTACGCTCCATTGAAGA
CTAAACCTTGATTCATCGTACAGGGATAACTCTGCGATCGGTACAGAGGAAGTTTCATCGGCTTCTGACATCTGTTGCGAGTCCATCATAGGTATATCAG
CGTGATCACTCCCCTCGCTAGCAATAGGTGCATTTTGGCGTCTGTgagacagcaacgacatGTACAACAACACTTGAATGTGAACTTTTGTACACAATTC
GGCGCACGCTTCACCAGATAGGCTGGTCGCAGCCATCAACTCCACGATATCTTGGATCTCACTCACCAAGTAAGAATTTCGTAATAGCTCAGTGAGAAAG
CGGGCCCGGTGCTTCGTGATCGATCGGGCTTCAGGGAACACCTTGGCCAGTTCGATAAGGATCTTCAGCATAGAATGACCGTGCTGCTCGTTTCCAGCTT
TCCAACTAAATTGTGGAAGCCTGTTGCTTCCACTCGCAGACCAGTCATTCGTTCCTGAAAGTGGAATACCGTTTAGATAAAGATGTTCCAACCAGCACTG
ATAAACCTCGTTGAAAAACTTTCCCGGTTCTTTGGCAATATCCATGCTTGCGAAGAAGAGGCTACTTGACTTCTTTAGTTTCCCACGGTGTGTTCCCGCT
TCCATCGCTTGGACAATTTTAGCAACTTCCGCTAGTTGCAACGATCCATCTGCAATCCTTTCCATTATGACGCGGAGGTAGAATCGATCAACTTGCAACT
CCTGAGAAATGCTGTCATACTTCACTGAAAATTGGGCGTGATTCCAAGTAGGTTCACAAACCGATTTTCGAGAAGCAACCAATAATATCACTGCGTTTTG
ACTGACTTTAAATCGATCAAACTCTTTGATGGTCGTCTCAAGGGAGATCCTCAATTCACTTCGAGTTTGTTCGTTCCAGATCAAGTCAGGAAGCAGGAAA
TCGTTGCCGACCATACTTGACAGGAGAGCCATATCTGTAGATGACTCCCCAGGGTAGTTCATACGGCTGGGGTCCTCCTTCACTTTCGCCTCTTTTATTG
ACCCACTGGCAAATAATGTCCCAATTTGTAGCTGCATACGACGAATGAACCACTCGGACCCGTCAACTTGACCCTTGGGTAAGTGTTTGCTCTTCCGCCG
AGTTGACTCAGTTTGCCGGGCTCGTTGTTTCTTCAACAGTTTCCGTACCATCGGGCTCGAAATCATGCGGATAAAGCCGTGGGGTAGCATTCGCACCAGC
ATCTCGTGGGAAGCTTTGTGGTGTGTAACCCAGATGCTTGCGATATACTGGTACGTCTCCTTCGCGTTGTCAGAAAGATGAAAGAATGCCTTATGTAGGT
GTTTCACAGTCAGCCCGGAATCCAATGCAACGTCGCAGATACGTCGTCGCACTCTGTGGTCGCCATGATCAACGATCACTTTTAAGACACAAACGACAGC
TGCTGATAACCCCGCATTCACATTTTGAGACgcgagctccagcaacagctgaTACTTTCCCCCAATGGCCTTTATAATAGCATCGAAGTGATTATTGTCC
GTGCTGTGGCGAGAAACGACCAGGACATCCAATACCAGTTGCAACATCACCAACGTGGAGCTTGGATTGCGTTGATCCAGGAGGCCAGTCAATAACGAAA
TCAATTTCTTGTACTCGAACACTTGATAGCGAATTGCCTTTTCAGCTGCTCGATGAGAATTTGACCGCGACTTATCGGCAATAAGGGAGTGGAAGGCATT
TACTGCCCACATCGTTGCAATAGAATCGCCAGATACTAGTACCTGCGCAAGAGTAGGCACAAGTACCATGGCACCGCCGTTTGCCTGCTCCATTGCAATT
CGATAGCAGCCATCATTAATGCGGCAAAACGTTTCTAATACCATACAGATCTCATTTGCGCGAATAGGCGGCTTGCAGGAGTGCTCAAGCTGACATAGTA
ACACAGGAAAGTGTCAGACTTAGAAATGACAACAAAATCAGTTGCACTTCACTTACCAGGACGTTCATCCCACGGAGCAAAGTGCTAAAGGAAAGCTTTT
CCAGACGCCCACGCATGGATTTCCCCGCGAAATCTTCAAGCTCCACGTTCATATTCAAGCTCTCCAGAGCAAACGTAACTCTGTTCGTCGAGGATGTCAC
ACTCACGCCTTCGCCGTTCATCGATTCGATTTCCTTATCAAGGGTTGCATGGGCAGGGATATATAGTCCGTCTTGGTTTAAATAGAGGAAGCGCTCATGA
TCATCCTTTAAAAGAGCTCTAGGGGACATTCTTGGATTGAGTTTAGGAAACTCTCGGCTGAGTGAAACGTCAAAATTATTGACGTAGCGATAGCCATCGT
ACAACGCCGCGAGGAATTTATCGAAGTCGTATGGCACATACACCACGCGACTGCAATCTGAAAACTCCAATGCCACTACAGCCTGCGCCTCATCACTCTC
GTGCCCAAGGGCTACAACACGTCGTAAATCTTTTAAATCATAGGACTTCCTTGAGCAGCTCGCAAGCTCTTGAATAGTTCCATCAACAAAGcatagtttt
ttttttcgcAAGCGCGTGAAGCCATGCCGCCCAGTCCGCCTTTGGACATTGAACACATCGTTCGATCCTAAGTCAGGATGGTCCAATGGCTTATCAGCTA
GCTGCTTGGGAAGCTTATCCCGCAATGTAGCGTGAAGATGGATCCCAATAACCCCGGCAAGAGCTATCATTTTTTCCACGATGTCATTGCTCTGGTCAGA
ATAGATATACTTCAGTTTCTTTTTCACTGCGAGGATGAACGCGTCAGGAAAAGCAACTGCTTGAGTAATTTTTTCAATCGACCGGTACTCGAACTCGTGA
GTGTTCCGATTGAGCATTCGAACAGAAATCAGAGCCCGCGGTGTCAGGTAAAGGGTGGTCTTTTCTCGTTGGCCATCTGCAGTGCCTATAAACCCACTGA
ACTGGAAACAATCAACGCTGTATGAGCGCTTAAATTCATCAAAGTTCCCCACCAAATGACTCATGAGCTCTTGCAAGAATATATTGCGGCATCGATAGCG
CAGCCGCAAGAATACGGGATCGTCGTATTGATCAATGCCCATCTTCAGAGAACCACACCCGGATTCAAGAAACTGTCGGTATTGCCGCAGGAGTATTTCC
GGGTTCTGAACGACCATCccaccagcgccagcaccaccgctAGAAGAAGATCCAGACGAGGAAAAAGTGTTTCGACTTGACGTGAAGTTATTTCTTCTGG
ATGAGTAAGTGTTTGGTCGAACGGTGTGCATGGTGCTTCCACGGTGGCTGCTCGGGCCAAAATTTAGTGTTTCGCCGAAGCTAAGCGTATGGCGCGGAAT
CTGACCGTCATGCGATCGAAGGGGGGAACCCATATTGCCGAAGTTCAGGAACGCTGGGTTTCTAGTCATTCGACTCAAAATTCCCACACACGCTTCCGCT
GTTGCCAACCCGGGAAAACTGAAAAGGATTCGGAGCATCATTCGGTACTTCGTCGCTAAGTGCTGGTACAGTTCCTCCGATAACTTCCGTTGTTTCTCCA
CATTTGCTTTAATCAAAAGGAAAACAAATTggcacagcttcatcgtcggcaGGTCGGACAAGAACGATCCCGTCTGGTCATCAAGCAAATGTGATACCAG
TTAGAATATGATAGCGCCAGAAATTTGGCCAGGTCAACTTACTGGCGGATCTTCGTCAAACAATGATAAAAGTGTCATCGTGAAGAGATTGTTAGACAAC
AGGAGCAGTCGgcactgcagcttgtgtGTCTTGGACTCCATCAGCCTACTCAGCACCATAAACATCCAATAAATCGCCACAGAATTTCTGCTCACCAAGA
TTTTAGAAATCGTGCTGATGTATTCTTCGCCACGCTAATCATATAAATTCACTGTTAGTTAAGTGCATCACAGTCGAGTACATCAAGATAACGTACCTCG
GTCAAAATACGCATAAACTCGTTGATAGCGGGAGGCGCAAGCATGAGACGATAGAGCGACTGAAGGTATGTGCTCACAAAATCGTGGGTTGCTCCGTGGC
GGTTCACGATATCATGTACTTCCCGTGCAATCACGAAAAGAACTTTTTCGAAGGGCTTATTCGGTTGGGCAATCACTCCAGGAGTGGGCGTATTTGCATT
TAACTCCACTGCCAGAGAGTGCATTTCTTCATCAAGACCACGCGGAAGCTGCCGCTGTGAGCGTGCTGTCTTTCGATAGCCATGAACAGACATCAGATGC
AAGATATTCGCCTGTGCAACACGCAGTTCGCGGTCCAGCACGTTCACATTCGGCATATTGttggcgatcttgctgccTTCTTGCGAGATAATTTTCCGTG
GGATCATACGCACCCACTCTTGAACTTCTGTCACCTCCACCCCCACCTGGTCATTCCCCAGAGCATGACACGATGCCAGTAGTTCACACACAATTTTTTC
ACGCTGAGCTGAGTAGTATTTGCGTCTGATTCCGTCCACATACACGATTTCAAATGCTTGCAGTGTATCTTGGTACAGTATCAAACTGTAAATCCGTGAT
AGTGGCCGACTGGTGATCACCGTGTTGACATCCACGTACTCCATAATGTACTTCTCCGAGACGGACAGCATCCTTGGGGCTGCAGTAGACTCGTTGGACT
GCGAAACCTTGAGCACTTGATACTCGAATGATACACTTGTTGTCAATGAGGTCCCTCCATCATCTTTCAGTGCAGCTTCCAtggtcttcttcctgtaCTC
GTTAATCTGCATACCATAAGCCTTCATGACTCTATTAATCGCTTGAGCGAGTTCTGTACGTTTAGACACCAAAAAGAGACTGGAATTGTCCGAATGGTTC
AATGCAATGGCTTCATGGTCGTCACAAATGACGTCAATGGAGACCAAACTCGTGTATGGGATGTGGGACATGAGATCTCCCTCTGTGTCTTTTTGGTAGA
TGCCATCAGGCCGGATTTCCACTACACAAGTGGATTGGATGCCAGACTTGTGGCACTTGAGGCTCTGGAACGTGTGAGTCTGGAGTTCTGGAGGTGTTGG
TTGTCCTGTCGGCATCTTGGCGTAGTGTTGACTCCGTAGTCTCATTAGACACACGAGAACTTCCATACGGAAGTGGCATCTGTACACAGTCTTCTTGATG
CGGTGGCGAGGTGTGTGGATAACGAAATCCGTTTCTCCTTCCAGGACATTTGAGccgtcgacgtcttcgtACGGCCATGTGTTGGTCACGTGTTGGTTCT
CCCGGTCCAGCGTCGAGAACGAGTACTCGCCGAAGCACAAGACGCGTTCCTTGACCACGAAGCTGCCCACCTTGTGCACCATGAAGCGCGCCACCACGCg
cttcatctccattgcG