Description :
From Genome Similarity Track
Location :
Scaffold_687:16031- 17111
Transcript NameFunction/comments
Phypl_g10326hypothetical protein

Sequence
1080 bases(100 bases per row)
GCTTCTGGATCCAGTGACGCCACGATCAAGCTTTGGCCAACCGAACTGCCGGTCACACAGCAAGAGAgcggcgaggaagaagccgacgagATCACGGGTA
CCGTCTGCCGACAATGGACGCgagatcttcttggccactCGTCCAGAATTTGGTATCTTGCTGCGAGCGCGTCGGGCGAACGTCTTTATTCAGGATCGGG
TGACGGCACTGTGAAGGTTTGGGATTTGCGTGCCGCTCTGGCTGAGCGTGCTGCGGCCCAGCAAGCTCtggatgatgacgacgatctTTTGAACGGCAAG
CGCGGATCTAATGTTATGCAGTCTGTGGTCGGAGCTGTAGCCGCTGTTACCCCAGGTGCTACATCTGCTATtgcagctgcaacgacgCTGCCTCACAATT
ACTCGGTGACCTCAGCAGAGTGCCTGGCCACGCTCATGGGTCCAAACGGCGGCGATGTGTACACAGTGAACCTGCATCCCAGCGAGACTCATTTGGTGAC
TGGAGGCTACGACCAGAGTGTGCGTTTGTGGGACATTGCCACTGGTGCTGTGGCGAAGACCTTCCGTGGGCACTTTGCGTCCGTGTGCGATGTCCAGTTC
AACAGGCACGCCAATTTCATCGTGAGCGGATCAAAGGATGGCACCATTCGGTTGTGGGATATCCTAAGTGGGCTGTGTGTCCACACATTACGCCAGACGC
TTGGTGAGGTCACGTCCATTTCGATGGCTTCGAATGGATACACACTGCTGAGTGGCTCGCGTAACAACAGCAATCGTCTGTGGGACCTGCGTATGCTTCA
TGCTCCTCGTGCGCACCTGTCAACCGGGCTCAGTAGTGGGGCGTCAAGTGGCGGGTCAAGCGGATCACTCAGTAGTTACTCGGTCGGAGGCATCGGAGGT
GTCGTCAATGGCTACGGGTCGGGTTACTCTTCCGCCAACGGCGTTGGGATTTCGGGAGGCGCTGGCtatggcagcagtggcaatCTGAGTGCAAGCGGAA
GTATTAGCGGTGGAAGCAATAACTTTTCGGGCAGCCGCCATGCAGAGCAACGACCGCTGCAGCGTTTCAAGGGTCATCAA