Description :
From Genome Similarity Track
Location :
Scaffold_567:1603- 3085
Sequence
1482 bases(100 bases per row)
TACATCTTGAGTGCTCTCGTGATTGTCTGCACCATGCGCTCGGCCGATCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTGTCGCTGCCCCAGGA
TCCGGTTGAATGCTCGAAAGAAATCGGACATAAAGCCTGGCTCCCGATCATGCCTAATCATCTCGCTAGCTCCAAATCTTCGGAAAACGCACTCCTCGTA
CGATTCAGCAATGGTTTGCGCAGTTCTAGACGCACTAGCTTTGGCTATCACGTATCCGGTAAACAGGTCCACCCAAATCAACAATTCTGTGTTTCCTTTG
AACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATATTCCCAGGTGACTCCCCTTCGATTGTGGGCCTGC
CCTTGCCTATCTCACAATCCACGCATTCACCGACGTATCGTTGTACGCTCTTGAATAGTCCTCTCCAGTGGAAACATTCCCGGATCCGTTGGTAGGTCCG
ACCAATACCCTGATGTCCGCCTTCCAGGCTAGCATGGTAGTGGTGTAGGACATCCTGTTGCAAGGTTTCTGGCATCACCAGTCTCATCAAATCCATCCCG
GTCCTCGTTGACTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACTGCGTAATCCGTAGCGATAATACTGTAGGATTTGGTATCCTCC
CGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCCAGGATCCACGCTTCCTCGTTCTGTGCTTTGAGGATCCGCTCAATGCGGACTCTCT
TCACAAATGTTTCCTCGAGAATTTGGGGGTTGGATCGAATCCTTCCTCTGGACCTAGTGACGGCCATCACCTGGACTGTCCTTTTCCCGGATCCAACTAC
CACCACTTCGTCTAGTCGGTTCAACGTAACGGGATCCTGATGCTCGGCCTCTCTCTCCAATTCAACACCACATTGATTCCGTAAAGCGGCGCTGGCCAAG
CTATCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCGCGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGG
CCGAGGCCTTGCAGTCAATCTCGCCTCGCACCTGTCTGATTACCAAATTTGAATCCCCACAAATCACCAACCTTTTCGGATCTTGTCCCTTTAGTAAATC
CAAACCCAGAAGGAGTCCGTTATACTCCGCCTCATTGACGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCGTACAACTTCCCATCCGGGCAGTCTCCAC
AGTATTGCACTGTATGCTCCCCCTCCGCGTCGTACACGAGCGGATCCATCGAAACTCAGGACGTATAGATCCTCATCCACCTGTACCGTCGGGATCGGGA
TCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGACCTTAGTCAGCGCTTCATCCATCTTAGCTCGAGGTGTGATGCTCAC