Description :
From Genome Similarity Track
Location :
Scaffold_524:16027- 17602
Transcript NameFunction/comments
g12183.t1XP_009529728.1 hypothetical protein PHYSODRAFT_263101 [Phytophthora sojae

Sequence
1575 bases(100 bases per row)
CCGAATACGTCGGAACGGCTGGCCTACAGGACTTGCCTTATACGTGTCATGCTATTGGCCAAAATACGGGATCTAATGTACAATGATTGGTTAAAATTGT
CCACCTTGGCTTTTATTGGCCTTTATGCTCAATACAAACTCAAAGTAAAGTCGGGTAGATTCTCATATTCAACCATACCAAACGATACTCACTGCAAAAT
CAAAAAGCGATCTAGAACTGTACATAATAGTAAATGTAGGATTCGTGTCGTCGGACAAATCACGCAAGCACCGATGAATTAAGGGTTGTGGGTGTTGTTG
CAGAGCTTCGGCCTGCTGCAAAATGTAAACGTGCGATCTCGCACAAGTATTAAATACGTGCACCCGGAGAAGTGACCAGTACACCGCCGCATGGCACGCG
CGAAGCAGGCTCAACTGGCGTTTCGTAACGGGCCACGCTAGCCTTCTGACAGGAGTCTTGTGGCGGCCAAACCTGGAGGCTTTCTTTATCTTACCGCCTG
ACTTGAGTTGCAGTTCCCCTTTTCGCGGTGTCTCACCCGCGCGCGGATTTTCGGTGCCCGCCACACAGCATTTTGCCTCCTTCTTGACTGCATGTAAAAG
TCTTTGTTCGCGATTCGCGAAGCAACTTGCAACTGGACAGGAGAGCCGCAAAAAACAGGCGAACCGCCGAGATTCTCATCCCACGTGAACACTTCAGAAG
CTTGGCTGGAGCTTTTCAAATGTCCCTCGCAGAGTCGCACTGCGACTCGCAGGGATAGTACGCTGATGATGACCGAGGCTGGGATGGAAAACCCGTCTCT
TATTGCTCCTCCATCATTTGGCGGTCGAAGATACTCAGACATCTACGACGTCGATGAATCACGCAAGTAACTTGTAGATTATAATACCGATTTGCTTCAC
GACGGCGAGCATCGCTTCGACGGCGGGCATGACGGCGATCAGCTCGATTGAAGAGGCTGGCGCTGTGCCCGGCGAGACGGTGACGACGGAGGTTTTCCGC
TTGTTTGCTTGTTATACTGCGCCCATCCTCGGCGCAGCTAGCACCGCACGAAAACCAATCCACGACGGTAGATCACGAGTCCTTTACCCAGACTAACTAC
CGGCAGAAACCATTTACTTTTGGCTCCACTGAAGGTTCTGTTTCGTGTTGAGACGAAGGCTTTTTACGGTCGCAGACAGAAGATCACGGCGAAATGCAGC
ATCTATTTCATCATCGGATCTGCGTCTGGAGATACTTTCGTTATCTGATGCTTCGGTTAGCAGATACTAGTACGCTGTGCTGCGAAAGGTGGAGAGCTCG
CAAGCAAAACGTAGTCTACTGTTGCGTTGCGCTTCCAGCATAACGCCTTCGACCAGCTCGAACAGCACTAAATCGTCCGGATTTAGAAACCATCTGATAC
TCCAGATGCCGTCTCCCATCGGCTCCTCCTATCGCGGTTCCCATACAAAACCCAACAGCAGCCGTCGCACCGTACGTCCTCACTCAGCAAAGGTTCAGCT
CCGACCGACAGGGAAAGTATACCAACAGCGCCACGCCCGGAAGTCCCGACACGAGATGCCGCTAGGAGACAAGCT