Description :
From Genome Similarity Track
Location :
contig_38:160250- 185168
Transcript NameFunction/comments
g7072.t1hypothetical protein
g7073.t1tyrosine aminotransferase, putative
g7074.t1glycoside hydrolase, putative
g7075.t1GTPase, putative
g7076.t1hypothetical protein

Sequence
24918 bases(100 bases per row)
ATCGGAAAAATCGGCAAAAATTCGACATCGTCTACCGCCACCACCTGGAGGGTGGCAATAGTTACGTACCTGTAAACTATTGCCACCCGGGGCAAAAATT
CCTGCAAGTCTATTGACACCGACTCGAGGTTGGCCGTTAAAATTTATTGACCGACTTCGTTTGGCTTACCGGTATTACGGTGCCCCACATGGTACCGCGT
ACCACCGATAAAACCCATAAAAAATACACGATTACCGTAGTTTTACTCATAACGCACGATATTTACTGGTTCATCATTGTACCGTTCATGAAGCTGTGTG
TCTGTTCTGGCTCAATCATGTACACGTATTGGTCTTGCCTTCTCCCTCACGGATCACTCGCACGCCGTTTGCCGCACGCAGCTCATGATGTATCCAAATG
AATGGCGAGTACACAACGTAATATAACCGTTATATTACTGACCATTATAAACAGAGGCCAGCTGAAAAACCACAATGAGATATGATTGGATGACCGTTAT
AAGCAGGTATTCGTAATAAGCCAAGGAAGTCGGTAACCCCAGATTCAACATTTGAATGTCGGCTGAAGTGTAGTGCAGGAGCTATCCCTGTTGCCCAGTC
CAGACATGGGATGGTCTGTCCGTGCGGCTCTCTCAAGTCTAACCATTGTTGTCTAACTAAGCATTGCTGGGCGCACGCATCCTGTACGCGCTTCAATATT
GCTCTCATGAACGCAGCCAATTCGAAGGTGTTCTCGAAAGGTGTTGTTGGGTACGCCCGAGGCTTCGCAAGCCCTCACTTTTCACTTCGTTCCGTCAAAC
GCACTCGTCCAGTCTCCAAGCTCCAGCGTCGCGCAAGTGCCATCCTCCGCGGGAGGTGAGGAGGAGGGCGAGGAGGAGGAAGTAAAAGATCGCTGAAGGA
GTCCCGACAGCCAATCCAAAAATGCTATTCTTTGCGGAACTCCCAGCGCGGACGTGAGGCTCGAGGAGAATGCTCCGTCGACTCGAGAGCTGCGCAACGG
ATGTCACGTCATGTGACCTGAACGACGGGACTGAGCACCGTCCAAGTTTGCTTCAAGACAAGACATAGCAGAGTGTCGCCGTGTGCCTATCTGGAGGTGG
GAGGGTTTGCATGGCGATAGCCGGCTCGGGCATGAGCCCTTTCGGGCTCTGTAGGCTACGTAGGTACCTATAGGACGCTCTTCAGGGATAATGGGTTAAT
TATCCATCTGGAACTGTTAACCACGGGGCTGACGCTTCATTCCGCCTGAAAGCATGGTCCTCTCGATCATAACTTCTCCATTGGAGAACGATATCGTCGA
ATCTTCAGTGCTTCGAATAACCTGCACCGTGACACGGTGCCAGACACATAGCGGCTGTGCCTTGACTGAAATGCAGCAGAAGATTTCCGTTCCTGGCGGG
TTTTGTACGTCACGAGGGTGCAGTGTACAGCAGGACCTGTCTTCTGGTCCGAGGGTTCCCTGGGTTTCAGTTCGGTTGCATTGAAGTTACTGTGTCAAAG
CGATGTTGCAGCAATCGACTTGGATATTGCTGACCTCGCCGAGCTATCCTACACGACGTCCGTCTCGCCCGCGGCCACTATCCTATATATATAATACCGA
GGTTGATACTTGCTGCGAGGAACGTGTGTGGGATCGGTTTTCTCGTGGGTTGCCTCGGCAGCGAGCGCTTCTCCATCCATCGTCGTGGAAGACCGCTCTC
TGGAGGTCGAGACATGGTGTGACCCCCCCAGCTGGCTGCGTTGAGACTTGCCCCAAGTCTCGATTGCAGGTGGAAATCTCTCTGCCGCATTGACCAAAAT
ATCCTCATTCTTCAATTCACTTCGAAACCGGCAGTAACGACTGTGGGTGCGGTTGTCGAGACCGGTTGGTAGCTGCACATGTTTTCCTTTTGACAGTCAC
AGGCCACGTCCTGCCGTGTGCAACACGCCATTCTCACTGTGATACTTGTTGCTTTCTCTCGCTTGCTCGGTCGTTCCCATCTGTCTGCCTGCTCAGAAGA
AATCTCGCTCTTCGACGGAGAGAAGACACGAACATTGACCCATTGGCAGGTAGCGGAGTGCGGCATCTGGTGGATTTCCCTCGATCAAGTGAAGTAAGGA
GGCAGAGAGAAGCAGCGATATAAGAAGGGGGAGGCCATGCCGGTTCAAGTGCGAAACAAGTTGCCTGGCAGAGAGCACCTGCCGGAGAAACCCATGCACC
AAGACTTCCCCGTGTTGTCCTGCAGCCTGGCAGTGAAGCCTGTCAAACGTAAACCGCTCGTGAAAAGCCGATTGGCAATGGTGGCCAACAGCGAGCGCGT
CAAGAAGCCGCGCCGCCTTCCCGGCGATGAGACCGTCTTCTACAGCAATATATGGTCGCCACCCGAGTCCACGCGGGACGTGCGTGTTTCCAAGAAGACG
ACGCAGCTCGTGGACATCAGCCAGGTAGCGCACGTACTCACGACTATTGACTACAAGAGTGGCTACGAAGTCCCATCCGACACGGCGTTTTTCAATATCT
GGGCGTCCATCGAATCGATACAGAATACCAAAAACGCCGCCATGATGAGCAAGACGCAGCAGAGCGCTAGTAATATGTCGACGCCCATTTCCGAACACAG
CAGCGAGGAATGTTCATCGGTGGCCACGTCGTCTAGTCAGTTGAGTCTCGGGCCACTGAGAATGGATGCGAGCGCGCTTCGACGAGAGCTTTCAGGAGAC
GATTTTACCATGGTGATGAGTGCTCCCGTGTCCGCCCCGCAGCGCAAGGGCGAGAATGTAGTGTTTTCGACAGTGTTAACGCACAAGGATGAAGTCGACA
TGAGCTGGAATTCGCAGTTCCTGCTGGGACTGCATGAACCAGTTCGGCACGCGCTTTTCGTAATCGATCGCTTCTTGGAGCGCAGCCGGAGCTTGAAGTC
GCCCATGAACTGGAACGTGGGCGCGTTTTTCATTTGGTTCAAGATGCACTTCGTCGAGTTTGTCCGAAACCAGCACGACGTGAAAACAAAGGTGCTGCTT
CCGCACGTGGTTATCAAGTTTGTGGAGAAGCGTGATATCGTTGCCCTGTACCAAGCTATTTTCACATTGGTGGATGTGATCGTTGAGCAGGAGGACGGAT
TGCTGCTATCAGCAGTCTCGTCAGCGGATTCATGGCAAGCTCGTTTGGGTCTACTTCAGGACGATATCCGACGTCTCAACCACCTGCTTTTCAACGTGCT
GGCGCTAGAAGAAGAAGCCTTCAAGCCCGCTATCGAGCTCGCATTTTCAGAAAAGGCTTTCCAGCGGTATGTGATGCCGCGTATCTTTCGCGCGACCAAA
CCCAAGCGCGTTATGGTACCATGGATTGTGGAGCGAAGTCGCGTCTGGGGTGGCACCAAGGTCGCTAAAGCGTATAAGGACGACCTGTCATTCACTGCGC
GGTTCCTATATGACCACGTGTGGCACCCGTACTTTGAAGCGAATATTGCATCTGCCATGAAACACTTGGGCAACGAAGTCGAAGGTATGGCTGCCAACGG
TTTGGATGAGTCGTGGTTTGGATGCTCGGTCATGTAGTGAGTGACCATTAACACCGCAGGTGTGCATCCGAGAGATCATGACAATATCGGAGCAGTGCTG
CTTCCAGCAATCGACACCAACAGAAGGACCGAACGTTCTCGTTTAGTATTTAAAAGGGAGCCCCAAATAAATTGTCGTTCCCTCTCGTTCGCGTTTGATC
GGTCAATAGTTTTCTTGCCGAGTTGCTGAGGATAACCAACCGCAAAATAGATCAAACGATGGAATTGAGGAACTCCAACACGCGCTTTGCGACCAGGAGC
TGCCTCGTTCTAAGCTTGATATCTTCCGTGCATTTGCTTTCCCCTTGCGAGCCGCGGCTTCTGCTCTCTTAGCTGCCGCAATTCCTTTTCTAGCACAGTC
ACGTTATCCTGATTGGGACTGTTGATCGCCTTGAGCAACGCGGAACACACCGCGACATTCGCCGCATATGCTGTAGTTGTCGAGAGTACAATCTTCCTCT
AGCTCGCAGCCCAACGGTTTGAGTTGCTGTTGGCTTTGCAACGCTGAGCACGGCCTCGTGGAAGCTAACGTCTCCGGGTTGCGATGTTTCCGAGCGCTTA
GCCATCATCCACAGCAGCGTAATGCATTTCAGGTCGTAGTCGATGGCGATGGCGACTGACGCCGACTTGGACCCACCTGCACTACACGTAGTGTGCAACT
CGCTCGTATCCGAAACGGAGCATCCAGTGGCGAGCGCCCGAGTCCTCCAAGCGCAGCCATTGCGGGCTACGCAAGCGTTGGCACGTCTTGCAGTGACATC
CATGACTGCAACGTCAACTGTCGAACATATTGGGCACTGTCGGTGTCGAATCGAACATATTGGGCACGTCGGTGTCCCGCGCAGTGCCAGCCATGCTTCA
ACTTGGTGTGCATTCCACACTACTCGATGTGCGGTACACAAATCTTAAATCTGCGACAAGGTTCACACCATCCATCCCAAAACCTGCGCGTAACGAGTGC
TTGGCGCAATGAGCGAGGTGGCCGAGAATCCGCCAACCAAGCAGGAAGGAACAGCGCTGCAGCCTCCCACGGACGCGCAAGGACATCCTGTGCGCGAGTG
GATTGACACGCTGCTGCAGGCGGCCGGAATCGCCAAGGACAAGCAAAAAACGCCTGCGCAGAGCGACGACAAGGCCGCGGTCAATCCAACAGACGCTACG
GCTGCACCCGACGACGCTAGTGTATCTACTACTGTTGCAGATGCAAAGGATGCTGCTGCAACTGATGCGACAACGAGTGAATCGAATAAAGAGGACGAAG
ACAAGGAGTCGTCACCGACGGTCTCCGATACAAAGGACGTTTCAATGGACCCTGCTGCCGATGAAGCAAAGCCCGGGGAAGGAGCTTCTGCTCCAGCGCC
GAAGCGATACCGCCGCCGGAGATGTGAAATAGAAGGTTGCTCCAAGTTCGCGCGCTTTAACAACGCCTGCTCGGGGCATGGCGGGCGGCGTCTGTGCGCG
GAGGCAGGCTGCGAGCGCGTAGCGCAGTTTGGCCACAAGTGCAGTGCACACGGTGGCATCAAGTTTTGCAGCGTCGAGGGTTGCCAACGTGCCGTGCAGT
CTCGTGGCTGCTGCAAGACCCACGGCGGAGGTGTGCGGTGCCAGTATCCCGACTGCACGAAGGGCGCCATATCCAAGGGCTTCTGTCGATCGCACGGTGG
TGGCTCGCGCTGTGCCGAGGAAGGCTGCGAGAAGTGGGCCCAGCGCCACGGATACTGCGTGCGCCACTCGAAGTCATCGTCTGCTCCGAAGGCGACGCCT
ATCCAACGAGCACGGGAACCCTCTGGTGACTCGACCGTTCCATCGCCAGAACCACTACCGAATAGCGCTTCGACTTAGCATCCTATCCATAGCACAGCAG
GAAAGCGTCGCAATATGAAATTGAGAAAACATCATGCTGTGTGCACCACACAATGTTTGGCATCACAATGGCGCGCGACCCGGTCTGCTACGCTGGCTTC
GCAGTGCAATGCGTGGCACCAAATCAATTGCCAAGGTTCGCTCCAGAGTCCGTTCACTTGCTGGAATCCTACGCGGCACATCGAGATACTGGTGAGAGAA
ATGCGATCTTTGGGTGCTGGTTGCAATGCCAGGAGCTCTAACACAACGTGTGCAATGAATTAGTGGTGGATATCGCGTGCAAAGAGCGATCGAGTGACTG
CTACTCCGGCAATGAGAAGGCCAGACAAAGTGTAGACCTGAAGTTTGGCGACTTCGTGGACTACTACCAAGCGACGTTCAGGAAGCAGTCGCATTGGCTG
CAGACGGTGGGTGGCCTGGAGTTTTATTTGGCGCAGTGCCCCATTGCAGTGCCCAAGCCCGATGCTACGTGCACCAAGGCAAGTCTGCCAGCCATAATGA
ACCATTTCCGCATGTAAGGTGGTTATTCTTGTCATCTCTTGAGCCTGCAACTCTGACGGGCTTGTTTGTGGGCTTGCTACTGCAGACCGGCATGCCTTCA
AGGCAAGTCTGTCACCCAAGTGAACCTGTGGATGACCGTGCAACCTGGCCGGACGACGCTGCACTACGACGCGTACCAAAACATCCTAGTGGTGTTGTAT
GGGAAGAAGGTTGTCACGCTGTATCCTCCGTCAGACACCGCTAAGATGTACCCGTACCCAGTGCATACCAAGTCTACAAATCACAGCCAAGTGAACATTG
TTCAGCCCGACTTCGCAAAACACCCACGCTTCAAGGAGGCGTCGGCGCAGCGCTTTGAAGTCGCTGCTGGAGGTATTGCTGATTGTATTTATGAGCGGTT
TACATCCTATCCTTTTTGTTCAGCCGTTGATAACAACTAAGGCGTTGTTAACTGTCCTCTGCAGATGCCGTTTTGATCCCGGAGGGGTGGTGGCACCAGG
TGGACTCGGACGAGTTTACCGTTGCCGTCAATTACTGGTGGAATGGCGTGCGAGATCAGCTCGTAGAAGACCCACGCATGGCGCCGTATTACGGCCGGGT
TATGCTGGAGGAGCTAGTGAAGCAGCAGTGCGAGTCGCGTCTGTCAGCCGTGCGGTCTTCAGCGGCAGCAGGTACCCAGAGTACATTCCAAGACGAAAGA
AGAGTGGTGGCAGCTATTGTTGCAGCAAACTCTCAGGAAACTCGCGAGAGGATTTTTCTATCGCTGGACGCCACCACTTCGTAAAAACTCAGCGACTCCT
GGCAACGGATCATGCCCCATGCTGGCGGGAACTGCTTGCGAATGCTAGCGTGGACTTGGTGATGGTCTTGGCCGACTGCTGGGAGAGCGATGACTTTGAG
GTGGATCTCCTTGGTGTGCTGTTTGGTGCTTTAGAAAGCGAGGAAGATGCGGTCAAGGAACAACTTGTGGCCAAGCAAGCGCAGTTCCGCCGAGAATGCG
CTGTCGAAATGTACCAGTCGCTATTTGGCTGAGCTTCAAGCACCTGTTCAACGTGAAGCCGTTACCCTAGGTTGAACTCGGGGCAGTCGACCAGCGAAAA
GCAACTTGTTGAGCGGCGGCAATTGGCTGAAATTAGTCCAAATGACGTCGGTGCCCGTCAGCGCGGGTAGATAGGGCAGAGATTGCCTTTTGCGTCTCTG
AGACGCCGTCTCAACAACAAGATTAGCCTGAACAGGGATGGCTCAACCAGACTCTCATTTCTTAATTGACCGCTCAACTCAAGTGTCTTCTGTCGTCATG
ACCAAGCGTGCCACCTTCGACGATCCTGCCTTTGACGTGCCGATGGTAGATGTCAAGCGTCAAGCCAAGCTCCAGTGGAATGTCCAGCCGTCCGACTTCT
CCAAGCTGTGCTCCAACCCTATTCGGAAAATCGTGGACAACATCAAGAAGCCCGCGACGTCGACCAAGACCCTCATTCCATTGTCGCTAGGTGGGTGACC
CTGTTTTGCGGGTAGTATTTATTTTTCAGAGCTAATCGGGAAACATTCGGCCGTGGCAGGTGACCCCACGGTGTTCGGCAATCTGCACTGCCCCGATGTG
CTCGTCCAGGCGATCGTACGAAACACCCGGTTCGTTGAAAGCATGACTTTCTGTCTAGCCGTTCTCGGCGCTGACCTTACTGTTTCTCTTGTTGCTTCAT
CAGTTCGATGCAGCACAATGGCTACATTCATTCTGCTGGCTCCGAGGCAGCTCGCGCAGCAATTGCCCAGCACTATGGCAATATGAGAGCTCCGTTGACT
ATGGATGACATTATTATCGCCAGTGGTTGCTCGGGGGCTATCGAGATTGCTCTGCGAGGTTTGCTGAACCCTGGTGACAACATCCTTCTCCCGAAGCCAG
GATTCCCGTTGTACCAGGCTCTCTGTGAAGCGCAGAAGATAGAGTGTCGGTTCTACAACTTGAAGGTGAGCTGCTCTGTCAACTAGTATACAACGTTCCC
TGTTTGCTAGACTAACGAATTATGCGATCAATGCTTGGACAGCCGGAGAGCAACTGGGAGGTCGATCTTGAGCATCTCTCGACTCTGGTGGATGATAACA
CCAAGGCCATCCTGGTGAACAACCCTTCCAATCCGTGCGGCAGTGTGTACTCGAAGGTGGGTAGTGGTGATGGTTTATTGGCGCCATTTCGTGGCCGTCG
CGATTTTGTTTTCAAGTGTCGTAGAGGGCTTCAATCTCTAACGTTCTGCATTTGCCGTGTCGTATAGCCCCACCTGGAAAAAATTCTTGCTCTTGCGGAG
CTGAACAAGATCCCCATCATCGCGGTATGCTCGTTCCTCCATATTTCCTATTGCATTCGTGAGTCTGACTCATTCCAATTGGCAGGATGAAATCTACGGC
GACATGGTGTTTGGCAGCAACGTATTTTTCCCCATCGCAACTTTGACGAAGACGGTGCCGGTCGTGGCCGTGGGCGGTTTGGCCAAGCAGTTCCTTATCC
CCGGCTGGAGGGTTGGTTGGGTCATGGTGCATGACCGCAACAACGTCCTGAGCGACGTGCGCACCGCCTACTTCAAGCTGTCGCAAAATATCCTTGGTGC
AACCTCGCTGGTCCAGGTAACAAAACGACATTCGTCGCATCTCATGGCTGCTTGAACGACAGCTAATATGTCCACGTCGTTTGCCTGTGCTGTCTACAGA
GTACCATCCCTGATCTGCTGACCCCCATTCCCGGTAGTGCCGAGGAGCAGTCTCTCATGGACTTTAAACAGCGGTACTTTTCGACGCTGGAGGCTAATGC
CAAATTCACGACCGACACCCTAAGGAAGATCCCGGGCCTGGAAGTGGTGATCCCGCAGGGCGCGATGTACGCGATGGTACGCAATATCCGCAACCGACTG
CCCACCAATATCCTAACTGGCACCTATGCTCTGTCGTCTACAGGTGAAAGTTCAAACGGACGTGCTGACCAAGATCAAGGACGACTTTGACCTAACGCAA
AAGCTGCTGGACGAAGAGTCCGTTTTCGTGTTGCCCGGACAGGTGCGTCCCAATATCCTAATTGTAGTTGCTGGATCCTTGGCTTGGCTAACCTGTGCCT
TCACTATCGTGCTGCCGAAAGTGCTTCGGACTGACAAACTACTTCCGCATCGTGTATTCGGCGCCGCACGAGGTGCTCGCGGACGCCTACACGCGCCTCG
CCGACTTCTGCTGCCGCCACCAGTAGCCTGAATTTACTTTATAATAGGGTTGAATCAGGCAAACAGTATGATGTTTATTTTCGTCCAATCGGCGTTCTTG
GCAAATCGCACGTAATTTCCCAATACTGATAACCTTTATGGACACATACTTTATTGTACATTGAATAGGACGGGTAGAGAGAGGGCTAGTAGGTCTACAC
TCTCAAAATAGATTCTGTATCATAGCCACAGTCCCTCTGTATTGTTATGGGTGCACCATCTGAAAATTCTCTGTTCGGAGGGAAAGACTGTCCGCGACTA
AACTGAATTTGCTCGCTGCCCGGGGGACGCCATGACTGGACGGAGCTTCCTGCTGCTGGCCGTGCTGGCCTTCGCCACGCTGCAGCACCTGACGGCAGCC
GCGGCCGTCGACGGTGTCATCGTTGTGCGCGGCAACAAGATGTACAATGCCAAGACGGGCGAGCGCTTCTTCATCAAAGGGTGCGTTCGAACGGCACGAA
AAGAGGATAGGAAGGAAGCGGGCCAACTAACACCAAAGAGCACAGTTCAGCATAGTAAATCCTAGTCTAATATGTGTGTGATCCTGTAGATGACGTACGA
GTACGCCGTGAGCGATGAATACTACGACAAGTATTCGAAGGCTGCGATCTCGGAGCACCTCTCGGGGCTCAAGTACAACACGTTGCGCCTGTACAACATC
AACCCGTCGTCCTCGTACAAGGAATTCATGAACGACATGGCCGCGCTCGGCGTGTACGTGATGGTTTCTGCCTCGCCCGATAACGACGCCTACTACGGCA
AGTACCGTTACTCGACCATCACCAAGGGTCTCAGCTGCTCCGGCAAGGTCTCGTCTGGAGATGGCGCTAAGACGGTGGATCAAACGGAGACCTGCTACCC
AGCGCTGCTGCTTGAGTACGGCAAGAAGATTATCCAGAATTTTGCGCAGTACGACAACACTCTCGGTGTCGTCGTGGCCAACGAAATCATGCAGGCGGAC
CTGACGGCCGGCTCCTGTGTGAAGGCCTACGTGGCGGATCTGAAGAACTGGATGACGGTGAACGGCAAGAAGATTCGTATCCTGCCGCTTGCCTACGCCG
CTGCTGACAGTAGCAACGATGAGGTCTCGAACGCGGACGACTACCATGTGATCAAATCCAGGGACTGCTCTGTGGAGACAAGATGACGAAGGGTATGATG
ACGGAGAGTATTGATATCTACCTGATTAACGAGTACCGTTGGTGCCCGGACTCAACCTTCGCGGAGGCGTATCAGCGTTACATCGACATGGCGCAAGGCA
TTCCCATCGTTGTCGCCTTCGGCGAATACGGCTGCAAGACTTCTTCGGCAGCGGCTCGCGACTGGGGAATGATTCCTTATCTGTACCAAGAGCCTTCTAA
GACGAAGGAGTTCACGGCGGTTTGGTCCGGTGGGCTGGCGTACTCGTATGGTGAAGCCAAGCTTTCGTCTGACTCGCTGTTCCCGATGTTCACTGGTACA
GCTCAGCTAGTTCATTCTTGTATACTATAGCGCACGGTGGGCTCATGTTGTGTCTGCATGTTTAGGTGGCAGCACGGACTTTTTGAGTACTCCCAGCTCC
AAGTCCACGACAGATTACACGAATCTGAAGGCCATGTTTGCCAAATACTCAGGCTATACGGATGATGCAGCATGGACCGACAGCACGAAGTGCACGTGGG
CTCCTACCCTTGAAACCAAGACGCAGTCGACCAACGAGCAGGCAACGAAGTACGGCTGGGTTGTAAGCAGCTGCTCTTCAGATCACATTAAGATCTCTAG
CTCAGACTCATGGACTTGCTCCAGTCGTGAAGGCGTGGTCTGCACGGACAGCGGTGCTACATGTGACGTGAAGCTGAGCTCTGCTGTCGGAACGACCCAG
GAGGACATTTGCGGCACGTACGAGGTTACGAGCGGTGGTGGCACTTGCGAGAGCACGTCCGACTGCGGCGGCAACGGCCAGTGCAAGGAGTCGAACGGTA
CCAAGTCGTGCAGCTGTCTGTCGTGCTACACTGGCACCGACTGCAGCGTCAAGGATATTTCCTCGTGCGCGACGCTCAGCAGCTCGGACACGGCCCCCCA
AACCATTTTCGTGGGCGTTGGCGTGTTCTTGGGTGTCATGGCGGTTGTCTTCATCGCCCTCGGTGTCGCAGCGGCTAAGAAGAAAGCTGGTACGTGCCTT
GTCGGAAGCCCATGCTAATATCCTATCGTCAAACTAATTGTGCTCTTGCATTCACAGAAACGGACAGATTGGCACAGGCGGTGAAGGCTGGCGGCACCAA
CCAAGCGACTGCTGCTGCTCTGTAGACAAGAGACGGCACTAGATCGTCCTGTATTGTGGCGGGCTCTACGAGCGCTGTGGCCTACCTACCCAATGAAACT
TTTCATGGTTTATTTGACACCATCATCACCCATTATCTGAGCCCTTGCCAAATAACCCTCCGTTTAGGTCCAGGGCTAAATATCTCAGTGATTTAAAGCC
CGCGACGAAAAGGGTTAAATCCGCAGCAAAAGCTCACGAGCGCCATTCGTCTAATTCGTCTAATAGCAAAGAGAGACACGAAGCACCCGCACCATGCCGC
CGAAGGGAAAGAAGACCGAAGAGGTAGATAGACCCAGTAACGTCACTGCAGGTGGGGACGCCTCCTCTCTCTAACTCTTATGCTGTCGTCCTCCCTCTCC
ACCCGCAGACCACGCGCACGTACCTGGGCCGCCCCGGTAACAACGTCAAGATCGGCATTGTGGGTGTCCCCAACGTGGGCAAGAGCACCTTCTTCAACTG
CCTGTCGAAGCTGCACATCCCCGCCGAGAACTTCCCCTTCTGCACCATCGACCCCAATGACGCCGTGGTGCCGCTGCCGGACCAGCGCTTCAACTGGCTC
GTGGACAAGTACCAGCCCGCCAGTGTCGTGCCGCCCGTCATGTCCATCACGGACATTGCCGGCCTTGTGCGCGGCGCCGCCGAGGGCGCTGGACTGGGCA
ATGCTTTCCTGTCGCACATCCAGGCCGTGGACGCTATCTACCACATGGTGCGCGCCTTCGACTCGACCGAGGTGACCCACGTGGAGGGCAACGTGGACCC
GGTGCGGGACATGCAGATCATCCAGGAGGAGCTGCGTCTCAAGGACATTGAGCGCGTCAAGAAGGAGTCCCAGGGCGTCAAGAAGCTCGCGGAGCGCGGC
GTCGGCGGCAAAGAGAAGAAGGTGGAGTACGAGTCTCTGGTCAAGATCCAGGAGTGGCTCGAGTCCGGCAAGGACGTGTCCTTCGGCACGTGGAGCGCCC
CGGAAGTCGAGCTGCTCAACACTATGCAGCTGCTCACGGCCAAGCCCGTGGTCTACCTCATCAACGTGAGCAAGCGCGACTACCTGCGCAAGAGCAACAA
GTACCTGCCCAAGATTGCCGAGTACATCAAGGAGCGTGGTGGCAACGAGCCCGTTCTCCCCATCAGTTGCGAGTTCGAGCTGGAGATGCTGGACTCGAGG
CTGGTGGCGAGCTCGAGACGTACCAGAAGGAGAACCCGACGCACAAGTCCATCCTGAATCGTGTGCTCCGCATGGGGTACCACGCCCTCGGTTTGATCCA
CTTCTTCACGGCTGGCAAGGACGAGGTGCGCGGCTGGACGATCCGCAAGGGCCGAATGGCACCCCAGGCGGCTGGAGTTATCCACACGGACTTCGAGAAA
GGCTTCATCATGGCCGAGGTGCAGGCGTTCGCTGATCTGAAAGAGCGTAAGTTTGTCTTTTCTGTTTGTGGTGCTGCGCGGTGCTGTTGAACTTTACTAA
CTTTACGTTTTGGAATTGTGCAGTGGGCACGGAGGAGGCGGTCAAGAAGGCTGGCAAGCTCAAGCAGCAGGGCAAGAAGTACGAGGTCCAGGACGGCGAC
ATTATTTTCTTCAAGTTCAACAACTAGGTAGGTCAACTGCTGCCGAGTGGTGTTGAGTGAGTCGAGCAACCGTGGTGCCAAGACCTCCGTTTTAGCCATG
TGTGGCCTGTGGTTTTGAGCCAAGTGGCAGGTAATGTCTTCGGGTCTAGAGCATGCGGATTGAAAAGCGCGGTTGCAGAGCATCCCGCAATGAAATAAAG
CATGCGCTTTGAGCACACTGGTCTACCACAAGCAAGTTCACACAAGGAGCAAGTGCGCTGTGTTTGGTTTTGGTTGCAGGAATAACGACTTGGAGCTGAA
GGGCTGCGATATCTTGGATTTGCCTTGACCCGTCGCGCCTCTTGCAACTGATCGCGTGGAGTTTTCACTCTGTGGCCTCCACTTAGCTCGGCGGATACGG
CAAAGCACACAAGCTCCAAGCCGAGGTGGTTTCGGTGTCGAGGTGAACCAAGTGGAAGGAATTCCGTCAGAGCGTCATCTAGGCAGCCCCGGAAAGGGCA
GAGCCGAAATGGTGTGTCACCTGGCCTGGTTGTTTTGTGCCTCTGCTGATTGAATCGTCTTATTGAATATGTTGTTGGATGCTTGGTGTTGACAGCCTAT
CGGGTATGGATGCGAACCAGAACTAGCGTGGATTGCGCCGAAACAGAATGGAGAAATCCCTGTCAAGCGATCTGGGCACTCGTTCACCTTGAAAGGCTCG
GAGACGGAGACTTCTGTCTATATGTTTGGTGGCTGCGATCATAAATCGCCACCAGGACCGACGAACGAGCTGTACAGGCTAGACGTCACAAACGGTAGGA
TGATCTGCAGGGTTAACCTTTAGTAATCAGAGAGTAACTCGATTTTGCTGCAGGTTACACGTGGTCGAAGGTAGCAAGCTCACAGAGTGAAGACGATGTG
CCAGCGCCGCGATGGAGGCACTCAGCCATCCTATTTGAGAAGAACATCATCATCTTTGGAGGCTTCGCCGCTGAAAAGCGAATGAATGACCTCTGGCTCT
TTAACACCGAGCTGAAGGTGTGGGAGCAGAAGTATGCTCAAGGTTTTTGGGAGGGGTTACCGCAATGCCGCGGTGCACACAGTGCCACTTTGGTAGATGA
AAAGATGTACGTATTTGGTGGCTATGGCGGCAACGGCTTTGGGCGTACCGACTTCAACGACCTTCACGCGTTGAACTTGCACTCATTTAAGTGGCAAGAG
ATTCAGACTGAGGGTGAGAAGCCTGAGCCACGATCGGGCCATCAAACGTGCCTTGTGAAGGAGCAACTGCTTGTCATCGGAGGGTGGAACAGCTTCAAGC
AGTTTCAAGATATCTTCGTTTTAGACATACCAACCAAGACATGGAGCTTGCTGAGCACGTCGCTTCATTCTCCAATCTGGAATCACACGTGTGTGAGTGT
CGCCGCTGTGCCTTACTGGAAAGTGTTCTTATTTGGTGGAAACAGTGGAGATCTGGCCGAGTCTGGAACGGCGCAAGGAGCTTATTTGAACAGCACTGCT
GTGTTGGATACTGGCAGTATGGTATGGCTAAACCCGCCTGTCAAAGGAGAGCCTCCGAAGGCCCGCGCTGATACTGCGATGGTGTTTGATGCAAATACCA
ATCACTTGATCTTCTTTGGAGGATGGGCAAATCGCTGGTACAATGACTTACACGTGCTTAATGCAAGCGAGATCGTTGGGCCGCCGTACTCAGTCCTGTC
GATCGAACCAAGGCAAGGTCCGATCACGGGAAATGCAAAGATAAAAATTTCTGGCTTCAACTTCACTGGCCAAAACGCTACACTGCGCTTCGCAGTTGCG
AAAGGCTCTGTCGACGTCACGGGAGCCGTTCTCAGTCCTAGTGTTATTCAAGCTACAGCTCCCAGCTTCGAGAAATTTGGACCGTTGACTTCCGAGGTTC
GAGTGTCGTTGTCCGGGGCATGTACACAAACGTCTCCACATCCTTCCGTTTTCACTCCGTCACAGCAGCCCCAAAGTCGCTAGCATTTGGTCCATGCTTA
ATTGCTGCCCTCAGTGATAATTGCCTGGCTGAGCTCCCGACTACATTTATCATCCAGACCAGAGATAAAGACGATAATCCGCGTGATTGTGGAGGGGATG
AGTTCACCATTGCTCTAAAGAACTGTGATGATGCCGAAGCCGAAGTGGAGCTGGTTGCATCCATCCTTGACAAAAATGACGGCACCTACGTGGTGACATT
TACACCATCTAAGGCAGGCAAATACGAGGTCTCGGTGGATTTTACTGGCACGTTTAGTGGTGTTGCAGGCCCAATTCGCGGCTCACCGTTCACCGCGGTA
TTCCAGCCGCCATCGGATGAGAATAAAACAAAGTGTTTGCCACCACTTGCAACTCAGAAGGACTTTGACTCGCCAGAGCTGATCCGGCGTGTGATGGCCA
CAATGAACAAGCGCAACGGAGAATTCCGGCGCATTCTTGTTGACTTGCGGAAAGACATCCCGAATAACGATACAGACGGCCTTGAGACTCTGCGGAAGAT
GAAAGAAATTATCCGCAAGCTAGAGACAGAAAAGGCAACGAATCACTTGATTCTGGACCAAGTGCGGCAGCTATTCTTCAATATCAAGAAGAGTGGGGGG
CATGTCGACAAGGAGCTCGTAGAAATCGAGAATATGGAGAAACTTTTTGTGGACGTCGAGAAGCAGATCCCAATGACCGAGAAGCGCACCCAGGAACCCA
CGCGGATTTTCAGCGAAAAGACAGAGGAGAAGATTATCGCGTACGAGAAGATGATCGCACAAAAGGTGGAGACTCTCAAGACGCTCGATTTCTGGTCATC
AAAGTTGGAGCCTGACAAGGGTCTTGAGAAAATTGAGAGTTATCTTGTCGACTGGAACGTGGAGATGAAGAAGTGCGAAGAAAACACTAAATTGTGTTCG
ACTTTCGGGTTTCCGCAACTAATGAATGAATCGCTTCGCATGATGGGTCTGATGCGGGCAGATGCAGATGCAATGAAAACCGTATGGGCAATCATTAAGC
GTGCAAAAGTTTTTTTCCAGGCAACCCAGGACTTATTGTTCAAAGAAGTGGACGTGAATGCGCTGCAGATTGAAGTTCAGTCTGCATTGAAAGAGCTCAA
AAAGATCCCCAAGGGGATTCAGTGGAGCGATGCGTACACCTCGATTTTGAAGGAATGCCAAGCATTTGATAAGACGCATCCACTTATTCGGTGCGTGTCA
TCCAGCTACATGCGACCTAGACACTGGAAGCGTATCATGGCTCACACGGGAGAGTTCCCTACACCGGACGAAGACCCAGAACAGCGGCTATCCCTGATTT
TGAGTAAGAATCTGTTCAACTTCAGTTCGGACATTAATGAGATTTGCTATGAAGCTGAGAAGGAACAGGAACTCGAGCTTAGGCTTATTGAGCTCGAGGC
ACTGTGGGCAGAGGTCAATTGGGAGATGTCTCCATACAACCCCGGTGCTGCCGAAGATGACATTGTTCCTCTCCTCAAGGTGTCTGAAGAGAACTTTGAA
CTCCTGGAGACGCATCAAATCGATGTACAAGGCATGAGCGCGTCACCGTATCAATCTGAGTTTGAGCCTCGCGTCGCGAAGCTTCAGATCGGACTTTCAT
CCATCAACGAAGTGGTGCTACTGCTGGGTGACATCCAGAGGTCGTGGAGCTACTTGGAACCGTTGTTATTCAGTCTGAAGAAGTGAAAAAACAGCTACCG
GAGTTGACCTCTGACTTTGAAGATATTGATCGAGAGGTCCGACAAATTCTGAAGACAGCGTGGAAAACGCTAAATGTGCAGGAAGCGTGTACCGACCCAG
GTCTCATCAAACGATTGGAGCTTATCGTGGAAAAACTAGAGCTATGCAAGCACCGCCTGAAAGAGTTCCTGGACGGGCGCCGCCGCCAGTTCCCACGATT
TTACTTTATGTCCGAAGCAGACTTGCTGGATATCCTGTCGAATGGATCTCACCCCGACCGGATTATGCCGCACTGCTCCAAAATCTACTTGGCGACCAAG
ACGCTCACTTTGGTAGATCGTGGCGCGGGAGAGCGGCCGGTCGCAACATCTTTCGTGGCTGGTGTTGGCCACGAAATTGTTGACTTCTTTGAGGCCCCAG
TGCTTGAGGGAGAAGCAGAAATTTATCTGGAGACTATCATGCGTGCTATGAGACTGACGTTGTTCAAGCATATTGATCGATCGCTTGTAGCTTACACGGA
AATGCCTCGTGTAGACTGGATCAACTTTAAGGATGACACAAACAAGCCGATGGATGCAGCCCAGATCATTCTACTGGCAGCAGGAGTGCATTACGTTCAA
GAAGTGGAGCGTGCCTTCCGTAGCATTCAAGGTGGCGAGAAGGATGCCTTGAAAAACTACAACAAGATGCAGGAGCAACAGCTAGAAGACCTGATTAAGC
TCACGCAAAGTAATATTTCGTATGCAGAGCGACAGCGAGTGATGGTACTTATTACGATGGACGCCCACGGCCGAGATATTGTAGCAAACATGATTCGTGC
CGGAGTGGAGGAGGCAACTCACTTCCAGTGGCAGTCCCAGCTAAAACACTACTTTTCACCAGCAGCGGGGAGCTTCTTGAAACGTGATAGTACATTCCGT
GGAGCAAACAATGCTCGAGCTCAGATTTTAATTTGTGATGCCGGTATTCCGTACGACTACGAATATCTTGGAAATGGTCCCCGACTGGTGATTACCCCAC
TGACCGATAGAATTTACGTGACGGCAACGCAAGCACTGAACCTGCAAATGGGATGTGCCCCTGCTGGTCCAGCTGGTACGGGTAAGACGGAGACAACAAA
AGATTTGGCTAACGCACTGGGGAAAGTGTGTTATGTGTTCAATTGTTCCCCCGAAATGGACTTTAAGAGTTTGGGAAACATTTTCAAAGGTCTTGCATCG
TCGGGTTCGTGGGGCTGCTTCGACGAGTTCAATCGTCTCGTGCCAGAAGTGTTGTCGGTGTGCTCTGTCCAATTTAAGGCTGTATGCGACGCGTGTAAAG
CTGACGACGAGAGATTTATCCTTGAGAATGACGAGGTGATGCTTGATCCAACAGTTGGTGCATTCATTACTATGAATCCAGGCTACTTAGGACGCTCTGA
GCTGCCCGAAGGTCTGAAAGCGTTGTTCCGCCCGATGACTGTCATGGTGCCCGATCTGGTGTTGATCTGTGAAAACATGCTTATGGCAGAAGGGTTCACC
CAGGCCAAGATCTTGGCATCAAAGTTTTACGGTTTGTATTCATTGCTAGGGCAACTTTTGTCCAAGCAGCTGCACTACGATTGGGGCCTTCGAGCTGTGA
AGAGTGTGCTATGCGTTGCCGGCGCATTTAAACGTGCAGAACCAGACATTCCTGAAACGGACCTGCTCATGCGCGCGCTGCGAGACTTCAACATCCCTAA
AATCGTTGCTGAGGATATGGTTGTTTTCTTCGGTCTTCTCGGAGATCTGTTCCCGCGTGATAGTCCGAATGTGGACGTTCGGAACGACCCTCCGCGTAAG
CGTGATATGGAGCTTGAATCCATGGTACAGGGCGCTTCAGAAGCAATCGGTAATACACCTCGCCCAGAGTTTATGCTGAAGGTTGTGCAGCTTCAGAATT
GTTGGCGATTCGGCATTGTGTCTTCGTGATGGGGCCACCAGCTTCAGGTAAAACAGAGACTTGGAAGACGCTGAAGAAGGCTCGCGAGATCATGGGCACT
CCTATGGAAGTCCAAGACCTAAACCCAAAATCGGTGAGCACGAACGAGCTTTACGGGTATATCGTGCTGAAGACACGCGAATGGAAAGATGGCTTGCTGT
CTCGAATTATGCGAGATCTGGGCTCTCGTCGCCGTGATAATGGTGATGAAGACAACAACCCCAAGTGGATTATTCTTGACGGAGATCTTGATGCTAACTG
GATTGAGTCGATGAACTCAGTCATGGACGATAACAGAATGCTTACGTTGGCCTCGAACGAGCGTATTCCACTGAAAGTTCACATGCGTATGATCTTCGAG
ATCCGTGATCTAGTCTACGCTACGCCGGCTACCGTATCTCGTGCCGGCATTCTCTACATTTCAACATCAGAGGGCTACCAGTGGCGCTGCCTGATTGACA
GTTGGCTTGATCGACACTGTCAGCAGCCTGTGGATCACCGCCTCAGAAATATGATGTTCACCCCAGACACGCGCTCCAAATTCCAAGCGCTTTTTGATCA
ATACATCGAAACGACCCTTCGGTTCTTCCGAAAGAAACTCGTCCCCGTGGTCCCTGTAGAAGAAACGACGCTCGTGACGAACTTATTGAACATGATCGAT
TGTCTGCTGACACCCCAAGTGTTGGAAGATTACACAGTGATGCAAAACACGTTCGTGTTCTGCTGTGTGTGGTCGTTTGGATCCATCCTCACCATGAGTG
ACGATGGCACGGACTACTCAGTCGAGTTTAGCAACTGGTGGAAAAACCAATGGAAGGACGTTAAGTTGGTGGCATCGGCCAGCAACACGGTGTTTGATTT
CTGGCTTGACCCGGAGACTTCGAAGTTTAATTCGTGGTCCAAGAGTCCGTACTTCTACACGGAGACGTATGTATCCCCAAGCCCAATCAACCAAATCACA
GTACCCACCACCGAACTGCATCCATTGCATTTTGGCTCGAGAACCTTATCTCAAAGAGCGTGCCGGTTATGGTGTGCGGGCCTGCAGGTACGGGCAAGAC
GCAGAATATCATGGGCATGCTAAAAAAGCTCAGCAAGGACGAGGCAACGGCTGCGTTCCGCTACTGTACGATCAATTTCAACTTCTACACCACGAGTTCC
ATCTTGCAGCAAACCATGTTTGGACAACTGGAGCGTAAAACCGGTATCAATCTTGGTCCACCCGGCAAAGCACGACTCATCTACTTCATGGATGATCTTA
ATCTGCCAGAGGTAGACCCATATAACACACAAAGTGCTATTTCTCTGCTGCGACAAGTGATGGAGTACAGACATTGGTTCGACCGCGTAAAACTTCAGAC
GCAAAATATTCTGAATACGCAAATGGTCTCCGGCATGAACCCTACAGCAGGTTCATTCCTGGTTGACCCTCGACTCCAGCGCCACTTCTGTACATTTGCT
ATGGGTATGCCTGAAGCACCAAGTCTGGTGACGATCTATGAAACGTTCCTGGGTGGGCATCTATCAGGCTTCGTTGATGAGCTGAGTAACTCCCAGTTCT
CTAACGCGCTTATCAAGGCTGCATTGAGTTTGCATGCCAGCGTTGTGAGCACGTTCCGCAAAACAGCAGCCAATTTTCACTACGAGTTCAATGTGCGCCA
CTTGTCCAATGTATTCCAAGGGCTTATCGCATCAAAAAAGGATCGTTTTAACAGCCAGGAGAAGTTCGTTTTGCTGTGGCTGCACGAAAGTGAACGCGTA
TACGGCGACCGACTTGTATGCAAAGCCGACATCGAAAAATACAACCAGCTCGTACAGATGCAAGTGAAAAAGTCATTCGCGTCGTGCAACACAAGCCGAT
ACTACGCTGCCGAGAACTCATGGCCCCTCATCTTTTGCCACTTCACTAAAGATGGCGATAGCGAGTACGACCAAATTATGGGGACGAACCTGGACGATCT
CAAGATGAACCTGCAAATCCAGCTGCGCGAATACAACAACAACGAGAACAATACGGCTATGCAGCTGGACCTGTTCGATGATGCTGTGAAGCACGTGGCT
CGCATTGTTCGTATCTTACGAAACGAAAGCGGGCATGCACTACTGGTAGGTGTGGGAGGTAGTGGCAAGCGCTCGCTCGCACGCTTAGCCTCGCATATCT
GCGGCTGTACTGTTCGTCAGATCACGATCAGTTCAAAGTACGGCGAAAATGAATTCAAGGAAGATTTGCGCAAAATGCACATGGCGGTAGTGGAAATGCT
GTCTCGTAATGAAGAAGATGGAGGTGTCGTATTCATGCTCACTGATTCTCAAATTACGAACGAAAAGTTCCTCATCTACTTGAACGATCTGCTGGCGTCG
GGAGAAATTCCAGATCTGTTCGCGATGGAGGATATGGACAATATCGTCAACTTGCTGTCTCCTGTAGCTGGTACGAAGGACCGCAAGGAAGTTGTCAAGT
TCTTCCAAGCAGAAATCCGTAAGCGACTCCACTTGTGCCTATGTTTTTCGCCTGTGGTGATGATTTCCGAAACCGTGCACGTAAGTTCCCCGCACTGGTG
AATTGCACAGTCATTGATTGGTTCCAGCCATGGCCTAAGGAAGCTTTACTTTCTGTCGGTCGCGAGAAACTGAAGGAGATTGGAGATCTGCTTGGGTCAG
ATGAGTCGCGCGCGGGTATTGAAACATTTATGCCGTTCTCATTTCAGTCGGTGAATCTCTGCGCCGAGCGGTTCTTCCAGGTGGAGCGCCGCCACGTGTA
CACAACACCCAAGTCGTACCTGGAGTTGCTTCAGCTGTACAAAAAGATTTTGCGCAAGAAAGTGGAGGAGTACGCTGCAGCCATCGATCGATTGGAGAAA
GGACTTCAAAAGCTTAAAGAAACTGGTGATACCGTGTCGAGACTTGAGGTGGAGCTTAAGGTTATCCTTGAGGCTGCTGAAGACAAGAAAGCTGTAGCGT
CTGGTATTGCTGAGGCTGTGAACAAAGAGAAGGCCAATGTGGAAACTGAAAGTAAAAAGGCTGGTGACGAAGCTGCAAAGTGTGCCGTTATCCAAACTGA
GGTTACAGAGAAACAACGTTCAACGCAGGAGGATCTTGCAAAAGCTGAACCTGCTGTAGAACAGGCTATGGCAGCACTTGACTCGTTGAACAAGAAGGAT
TTGGGCGAGTGTAAAACAATGTCGAAGCCTCCTGCTGGTGTAGACGATGTCTTTTCAGCTACCATGGTTCTGCTGGCTGGTGTCCACCCGAACGTTCAAG
TTACCAAGACTGGTAAGGTGAAGGATGTCAAATGGGACACCGCCAAGAAGCAGCTTCTGGGTAACATCCCTGAGTACATTGACTATTTGGTGGGCTTCAA
GCAGGTCGTAGACGACGGCAAGGTACCTCTCACGAACTGGAAAGAGGTGCGCGTGTTCTTAGAGATGGAACACTTCAACTACGATACGATTCTCACAAAG
AACAAGGCTGCTGCCGGTTTGTGTTCATGGGTCATCAACATCGTCATGTACTACGATATCGTCATCACGGTCGAGCCGAAGCGACAAGCTTTGGCCGCTG
CCAACCTTGAGCTTGAGGCTGCAAATGCTCGTCTAACCGAAGTGACCGAGCTTGTGGCTGATCTGCAGGCAAAGTAGACAAGCTGCTGGCCGAGGCAGCT
GCAGCCGAGAAGGAGAAAGAAGACGCAATTAATGCTGTTGAGACCGGAAATCGCAAGATGAAGCTCGCAGGCACCCTGACTAATGATCTTTCAAGTGAAA
ACGTACGTTGGGGGATCAATGTGCTGCAACTTCAAAAGGAGAAGGATCTACTGGTGGGCGATGTGCTGCTTGCATCTGCTTTCATCTCATACATTGGCCC
GTTCACGAAGCCCTTCCGAGATGAACTCATTAACAAGCATTGGGCCTTACCTGCGCACTGCAGCCGGAGGCGAAAGCATTGCTATGTCGGAAGAAGCCAA
CCCACTACTCATTCTGACAAACGATGCGCAGATCGCCGAGTGGAACACTCAGAAGCTTCCGTCAGATCGAGTGTCAACGGAAAATGGTGCTATTGTGGTG
ACCACAGTGTCTATGGGACGAAGACCACTTATCGTCGACCCGCAGTTGCAAGCTATTGCATGGATTCGTGAAATGGAAGCGCACAACAACCTTATCATTG
TGCGAGTTGGTCAGAAAATGTGGATTGAGCGTCTCAAAACGGCAATTGGCACGGATGGTGCCTTCCTCATCGAGAACTTGGGCGAGAAGATTGACCCCAT
CTTGGCTCCTGTCATTCAGCGCTCAACTTCACGTCGTGGCGCCCGGTACGAGATCCAAATCGGTGATGCTTCCGTCCCGTACAACGACAACTTCCACTTG
TACCTGCACACAAAGCTGGGCAATCCCACTACCCGCCTGAGATTCAAGCAGAATGCACCATTGTTAACTTTACTGTCACGATGCTTGGCCTTGAAGACCA
GTTGCTGAACCTTGTTGTGTCCAAGGAACGCCAAGATCTGGCCATTAAACGCGAGAAGTTGATCCAGGAACAGAATAACGGCAAGATCGAGCTCAAGAAG
CTAGAGGATGATATCCTGTTCTACTTGGCAAGTGCAGACGATGATATCACGAACAACCAGCCGCTTATCCAGATTCTGAGCGACACAAAACACAAAGCCC
AACGTACCCAGAACAATATGGAGGCTGCTAAGAAGACGCAAGAGTCCGTGAACATTACGAGTGAAAAGTACCGCAGCATCGCCGCGCGAGGCTCGTTATG
TTCTTCCTGATGAACGACATCAGCAAGGTGCACTGCTACTACATCTACTCGCTGGCATCCTTCCAGCAGGTTTTCTTGTCTGGTATCTACCGCGCGCCAG
CAGCGAATAATCTCATTGCTGATGGTGCAGGAGAAGGTGAAGCTGCACCTGCAGCTGATGCTGGGGCAGCAGCCTCAACGGAAGGTGGAGACGACGGAGG
GGGTGATGAAGATGCTGAGGAGACCGAATCCGCCGTCGCAGATCTGACAGATGAAGAGATGAAGGAGCGATGCCAAGTGCTAATGGACAGTATCACCTCG
TGCGTGTACAACTACGTTCGTCGCGGACTCTTCGAGCGCAACAAGCTCACGGTAGCGACAATGTTGTGTCTGAAGATTTTGCTGAAGGACGGGTTGTTGA
GCGATTCCGAAGTCGAGTATTTCCTCATTAGCAAAGCCCACCCGGACGCAGGAAATGCTGGATCAGCCTCAGAGTGGCTCCCTGCAGCAATCTGGGCCAA
ATTGAAAGCACTAGAGAGCGCCAAGGTCTTCCAAGGCCTAGGAGACGCGATCCAAAATGACCCGGACGAGTGGAGAAAGTGGTTTGCAACCGAGGATGCC
GAGCGACAGAAGATCCCGGGGACTTCATAAAGCTTACAGCTTTCCAGCGATTGATATTGCTGCGCGCCATGCGACCCGATCGTGTCACCAATGCTCTGCG
TACATTTATCCTTGACTCGTTGGGCGAGGAGTATGTCACTCAACCACCGTTTAATATGGAGTCTACTTACGCAGAGACGAACTCAAGTATTCCGATCTTC
TTTGTACTGTTCCCCGGTGTAGATCCAACGCCATGGGTCGAAACGCTCGGTAAAGCTAATGGCGTGAGTCTAGAGAACAACAATTTCATCAATATCTCCA
TGGGCCAAGGTCAAGAAGCGTACGCCGGAGACGCATTGAAGCGATTAAGTACTGAGGGTGGCTGGATTATTTTGCAAAACGTGCACTTGATGCAGTCATG
GTTGCCGACACTGGAGCGGCAGTTGGAGGAGGTGGCTACTGAAGGTGCACATGAACTCTTCCGATGCTTTATCTCAGCTGAACCGCCCCCGCTGCCTGAC
ATGCTGAACATTCCTGAGTCGCTACTCCAAAGCTGTATTAAAGTCGCCAACGAGGCTCCCTCAGATATCCAGTCGAACCTACGACGTGCTTGGGCCAACT
TTGGTGAGGATAAGGTGCAGGCCTGCACTAAACCATCGGAATTCAAGGCTTGTCTTTTCTCTCTGTGCTGGTTCCACGCTATCGTGCTAGGAAGGCGGCG
ATTTGGTCAACAAGGATGGAGTCGAGCGTACAGCTTCAACACGGGAGACCTCACCATTTGCGCCAATATTCTTCACTCGTACCTGGACAACAATGTATCC
GTTCCATGGGACGATTTGCGCTATCTCTTTGGTGAAATCATGTACGGTGGCCACATCACGGATGCCTGGGACCGTCGTACAAACAACACGTACCTGAAAG
TGCTCATCGATCCAGGAC