Description :
From Genome Similarity Track
Location :
Scaffold_1118:1602- 3594
Transcript NameFunction/comments
Phyke_g11848hypothetical protein PHYSODRAFT_517932

Sequence
1992 bases(100 bases per row)
GGATAATCCATGTCGAAGCAGAGAAAGCGTCCGGGAAGAGGCCGTCCAGCAATGTGCCTCCCAGTACCAGGAACACGCATGGGACCAACAGGCAGTTGGC
CATTTGAGAGACGACAGAAAGGTAGCGGCCAGGCTTTCCCATGGCCCACTCACCTAGGTCGCCGTACGTCTTAACGGACGTAGGTGCGAGCAGCATCACG
CGACAGATCGCCACAGCGCCGTAGACGTTAGCGAAAGccatgaagatcatggcgAGGATGGCGATCACAGGGCCGGCGCGGGAGAAGTTACCGGGCATAC
CAAGCGTACCAATACCgtagacgcagcagaagaggttgaaggccgccttggcgtcctccaccGTGAAGAAAGCTTTGCGAGGCATAGTAGCAGAGTCTTG
GATTACAGCAGTCGCGGCACCGGCGTTATTGTCGTGGAGTTGTGATGGCAGCGGACTTGAGCTAAAGCAGGAAAATCCGGAAGTGAGGAGTGGTGTCTTG
CAGGTCAGAGAGAAAAGTTCCGAATCGGGACTTCCGGTTAATGCGGTGGNCTGCCGAGGTTGTTAAACGAACGACAGAGAGTAGTGTGCTCAACGTACAC
GGGTATTGAAGTTGAACTGATTTCTCGTGCAGTGCTCATGACGCTTCAAGATTTGCCGCAGAGAGTCGGAGTCCTTCAGCAGGATACAGGACACCATTCC
CTATCAACAGACCTCATAAAAAAGGCAATAATACCCCTCTTCCTAGGCTTTCTGGAAAAGGTACTCAAAAGAGGCATTCGTTCAATTACTCAAGTTTTAA
GTGTAATTTGTACAACCATTCGAATTTCTAAGTGTTTACCAGACTCCTCCCGGCCAGATTGATCAAACCGAAGTACTGTTGCGCTTGGAGTTGGCTCTCC
ATCGCGTAATTGCTGAGAGACGGTAGCTGTGAATTCTTAACTTGCTTCAGCAAACTGAAATCACTCTCGACAGTATGCGTTCCAGGCGATATAACGGCTA
ATCCAACTGGAAAGGAGGAGGTTGTACTTCTGCTCGCCATCCACGGTCGTCCACGCATCTGTGCACACAGCTCGCGAGACACCATCGTCTCGTCGGTGAA
AACTGCTCTTCTTACTGCGGCGTTCGATAAGCTGTCATCTCTGTTTCCAAATGCATCTAGAACGCAAGAATTCGTCTTCTCATGCCGTGGCCTCTACAAC
ATACAGAACCGATTCAAACAACTATTATAATAAGGCCATGCATGCATTTAAAGTCAACTGTGCGAGGTTCATGACTTCGCCACACCTTTTTCAGCGTCAC
TCCAAGAGGCGTTCGGTACTTTCTCCACGTTTTACCTAATTTAAGAGACCCGCTTATCAAGTTGCACCATACTGTATGGCGTGTACAGTGTGTCGATTAA
CAATGTCATCTGACTAACAGATTAATCAAATTTTAATCAGTTGGCACATAAATGTGCGATAGGCGATTAACCTCGATTTGTTTTGGGCTGGTTAGGCTCA
CGCCTACAAATAACAACATAGAATTTTGGATGACGATGCATCGGTGATGGACTAAGATGTAATTGTCGGTTTAGTTGTGGTGTACTTCCATAGTACCAGC
TAGTGCATGGAAGCCAGCGAATCGTTGTGGCATTTAGGACAACGACCATACCAGCACATGGTTAACCATGAACTTCATCTGAAgcttcgccttcgtcttg
ACTGCTGTACATACTGGCCCCTACATTAGCAGCGTGGATGGTGCGGATACTCCGAGCTTCGTAGATGAGCTGCACTAGAAGCCACTACGACTTCTGAACA
AAATAAGGACAATTCGTGATGAGCGTTTTCAGCTGTATCATGTAAACACCAACACCGGCAAGTGCATATCAAGATGATGAATTTGATAGGACAAACTCTC
AATGACGCGCAGGTGCGTACACTTAACAGGCTCCGACTCTATTAGCAAAGCCAGGTGTTAAACGATCTTCAAAGGTCCGACAACCCCCCAAC