Description :
From Genome Similarity Track
Location :
Scaffold_697:1602- 2713
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_697-fgenesh-gene-0.026S proteasome non-ATPase regulatory subunit 7

Sequence
1111 bases(100 bases per row)
AGACAAGACGAGATGGCGGACGTGAAGATCGCAGCGAGCGACGTGAAGCTGCCGGAGGAGGTGGTGACGCACCCGCTGGTGCTGCTGAGCATCGTGGATC
ACTATAACCGCGTGGCCAGGGACACGAGCAAGCGCGTCGTGGGCGTGCTGCTCGGCAGCACCTTCCAGGGCAAGTGCGACATCACCAACTCCTTCGCCGT
GCCCTTCGACGAGGACCTGCGCAACCCGGGCATCTGGTACCTCGACCATGACTTCCTCGAGAGCATGTACCACATGTTCAAGAAGATTAACGGTGCGTCT
CTTGCGTCCTGTGATGCTATGCATGACTCTGGTGGGTTAATTACTGACTGCGATTGACTGTATAGCCAAGGAGCGCATCGTGGGCTTCTACAGCACGGGC
CCGAAGATCCGCAAGCCGGACCTGGAGATCGACGAGCTCTTCCGACGCTACTGCCCGAACCCAGTGCTCGTGATCTGCGACGTGCGCGCGAACGTCGAGG
GCCTGCCGACCACGGCCTACGGCTCGGTCGAGGAGGTCGAGGAGGACGGCAAGGCGATCAAGCGCATCTTCAAGCACATCAAGCCGACCATTGGCGCGTA
CGAGGCTGAGGAGGTCGGCGTTGAGCACCTGCTGCGCGACATCAATGACCCGTCCGTGAGCTCGCTCGCGGGCCACGTCAAGCACAAGATGACGGCGCTC
GCCGGTCTGAAAGAGCGCCTCGAGGAGATGAAGACGTACCTGGAGAACGTGGTCGCGGGCAAGCTGCCGCCGAACCACCAGATCATCTACAACATGCAGA
CGGTCTTTAACCTGCTGCCGAACCTCAACGTCGACTCGCTCGTGCGCTCCATGTTTGTCAAGACCAACGACATGCACTTTGTACGTGGCTCTCTCAGGAG
GCGTTTGTTGACGGGGACTGAGGATTACCAACTGACCTGGTGGTGATGTATCTCTTATGTGTAACTAGGTGATCTATTTATCGTCGCTCATCCGGTGCAC
GATCGCGCTACACAACCTCGTGAACAACAAGATCAAGTACAAGGAGCAGGAAGAGCTCGGCTTTGCGGACAAGAAGGACGAGAAGAAGGACGCAGCAGCC
GTGGTGCCTGC