Description :
From Genome Similarity Track
Location :
Scaffold_813:1602- 2703
Sequence
1101 bases(100 bases per row)
NNNNNNNNNNTTGTACAAAAGCGATGCGTGAATTGCAAAACTGCATTAGTTAAGACTTCCCAAAAATGACTGCATCGGTAGCAACATCCAAGGGAAAGGG
ATGCTCACCAATCATCCCAAATCTTTCGGATTAGGTTCGAAACATGCGAGCTAGATTTGATGTCCTAATTATTTCACCTTGCGATGTCCCCGGAAACTTT
TGGCCAAACTGATCGACGAATTTCACTTATCGAACGCCTTCAATAATCTCTCCACTTTGTCACACAGGGATTTCTACGACGGAGCTGGTATCAATATGTC
GTCGTTATAGTATCTTCGACCCAACACCGATGGTTTCGGATTGGTATCTGGGTCACCGTCGGTAAAGATATTGATCAACTTCGGTGATCCGGCCGTGATC
ATTTCGGATCTTGCGCCGATTTTCAAATATCCGTACAGAGCGTTATCGATATATCGTTGGTAAATCTGTGGANNNNNNNNNNATCAATCAGATTCGGTGA
TCCGGCCGCGATCGATTCGGACCTTGCGCCGATCTTCAAATATCCATACAGAGCGTTACCGATCAGTCGCTGGTAAATCTGTGCAGCGTTTTGAGCCCGA
AGGCATCCGTAACTACTCAACCCTGATGGTGTGATAAAAGCGGAAATCGCCCTTGGCCTCTCAGTCATTTCCAACACCCAAGAACCACTCGACATGTCCA
GTGAACATTACCACATGGCTTTATCCATNNNNNNNNNNACCCATGTCTTGCGATAGATCACTGATCCGACGCATAAGGTATACCATCAACCTAGTCAGCT
CGTTCACCCTCCTGTGATCAATACACAGCCTTATAGCTTCTTCGTTTTTCTTTATGNNNNNNNNNNCACCCTCCTGGTTCACCCTCCTGTAGTCAATACA
CAGCCTTATTTCTTCTTCATTTTTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGAAG
GGGTTGTCTCCATCCACATCTATATCAAAGACTACCCCACGTGCCGCAAGTGGCAGGGCATTACCTTTTCCAATCAGCAAATNNNNNNNNNNATATGTCG
C