Description :
From Genome Similarity Track
Location :
Scaffold_69:160176- 163214
Transcript NameFunction/comments
Physo_139026pol protein

Sequence
3038 bases(100 bases per row)
GTACCAACCTATAAATACATTCAGTCTTAGATCTACCGCTTTTCAAGTCAAGTCGTCCCCTTCCGACCAGGGACACGTGAACGGCTGTTCACTTGGAGTT
TGTATACTCCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCACACTTGGTAGCACTTGTAGTCAATCCTACGCCTACGCGGATAGATTGGACTACC
TGAATCCTTTGTGGTCTCATCGAGTGAGCCAAGATGGATCGGACGGAGTTTCCTCATCTGAGCGACTCGCAGTACGAGTCCGTTCGGAAGATGGCAGGCA
TCTTTGGGACAGATGCCTGCGTAGTTTAGCGGCGGCGACGCCGGCTGAGCAGGTTGAGCGTATCAACGCGTTCGACACCTACGAGCGAGGGCTCCTCGCC
CACGTTCAAGGGCTGCAGGCCACTGCGGCTGAAGGTTCACCCCTTCGAAGGGAAGGAAGACGAAAACCTTCACTTCTGGGTTCGAGTGGTCGAGCTCGCG
ATGGACGCGGCTCTCGTCTCGGACGAGCGACTCCGTGTCGCCTTTGCGCTCTCCAACCTTAGTGGTCGCGCTAAGAGTTGGGCGTACACGCACGAAGCAA
CGACGGCTGGATGCTTCGCATCATGGTCCCAGCTGTGCGAGCAGCAGCGGGCCGCGTTTCTTCCGGCGAACTACGAGTACCGCCAGCGCTCGCGCTTCCT
CGCCTGCAAACAAGGAAGGCGCGAGTTGCATGAGTACATCCAGGAGATGCGAGTGCTCACTGCCTCTTTGGTGGGGAACCCCCTGCCTGAACACATCAAG
GTGACCGTGTTCATGGACGGTCTGCGCGTCGGTCCTGCCCGCACACAACTGTTCTGTGTGCAAGCGAACACTATGGAGGAGGCGATTCAGATCGCTCTCC
AGGAGGAGTACAGTCACAAGCAGGCTCGTACCCCCGCCACGGTATGGTAGAGCAACCGTGCCTCTGGCGGTGCGCCTTATGGTAACTCCGGCAATGGAGC
GTCCAACGGGCCGGTTCCCATGGATCTGGGCATGGCCGAGCAGAGCGACATTCGCTGCTACGGCTGTGGCAAGCTTGGGCACATGAAACGGGAGGACTGA
AGAAGAAGTTGTCTTCGAAGCCCTTTGGCTCTAGGGGTCGCTGGCAGAAGCCGCGCCCCAGGAACCAGGGGAACGCCGGGCACCAGTGGGGGCGGGGCGC
CCTACTGGGGAAACACTAAGTCTTCATGAGGGGCGTGCGGGTGGCGCACGCCATGGGGACTTAGTCCCTGAGATTCTCTGTACTCTCGAAGCGGAGAAGG
GCAGCGGTGGGCTGCTTGTGGTGTACGCGAGTGTACCGGGATACGATCATCCCTTGAGAATCTTGATCGACTCTGGGGCGTCCAAGAACTTTGCGTGCCG
CCAGACTGTCGCACGCAATCGTGACAAGTACGCCGATGCGCTACGAGGCAGCAAAGGCAACGGGCTGGTCTCGGTAAGACTGGCCGACGGTACGGTGGTA
GAAGTACCTCGGGTCCACATGGACCTCGCTATCAAGTTCGAGGACTTCGACAGCACGGAGCCGTTCTTGGTCCTACACATGGACAAGTACGACTTGATCC
TTGGCATGCCGTGGTTGGAGAAACACGAGCCTTGGGTCGACTGGCGCGGCAAGGCCATCAGGGCCAGCCGTCCCCCACGCTCTGACAGAGCTTTGGTGAG
TCATGCTCCCACCTCTGGATGCAGCTGGGGCGCCCGCGAGGGCCGCCAGGGCGCAGCAGCGTCCAGCGAGTTTTGGGTTCCGTCGAGACTGACGACGACT
CCGGCCGGGCCGGACAAGGTCTGAGAGTGGAGGTGCCTACCAGGTGGGTAACTTAGGTCCACACGCGAGTAACGAAGTACCGCAGGCAGCAAGGGCTGCT
GGAGAAGGCGTCGCTGACGCTGGCGTGGATAACCAAGTTCCACGCAAGGTCACTCAGACCGTAACGGATGAGGAAGGCACTGCAGGCGCTTCCGATGTGG
GTAACATAGTTCCACAGGAAGTCACTCAGACCATAACTGATGCGGGAGTCGCTGGGAGCGCTCCAGGTGTGGGTAACCAAGTTCCACACGGCGAGGTGGG
TAACATAGTTCCACCCAGCAAGGCGGGTAACCAAGTTCCGCTCAAGGACAAGGCGGGTAACATAGTTCCGCACACGATCGAGAAGATCGGTGGTGCTGTC
AAGGCGGCGCCACGAGATGAAGACACCCGAGGGTCACGTCGTAAGCCGGGCCTAGTCGCGTGGTCGACGACGCCAGTCGCCAGCGACTCCGAGCCTCGAG
TCAAGGCTCCGGCCGCCGAAGAATGTTATCACACCTTTGACGGCGTGACCGGTCGTCGGGTCAAGGCACGAGCTGTCGAGTTTACTGCTCTGCCCGAGGT
TTCCGAGTTGCTGAACCTTGAAGGGCTCGCCATGGAGGACTTCTTGGCCGAGCTAAAGGCCGGGGAGATCGCAGAATTGGTTCTCCTCCGACCGGAGTCC
ACGTCGGCCGAGTTGAACTCGTCCTCGGTCATGACCACGGAAGTCCTGGAGGAGTTCCAGAGGCAGCGCGCGTCGCGCATAGGCTCTGCGATTCTCAAGA
ACCCCCGGGACCCGGTGTATCCCTTGGTAAAAGAGTTCGAGGACGTGGTGTCCAAGGACCCACCGTCCAATCTCCCTCCGGGCAGGGGAATCAGGCACGA
GATTGACCTCGTGCCGGGCACGAAATACTGTGTCACGAGGCAATGGTCTCTTCCCCGGGAGCAGTGTGAAGTCATTGATGCCTTCATTGCCGCCAAGGCG
AAGGCAGGCATGGTGTGGGAGTCAAAGTCCCCGCACTCGACGCCTACCTTCTGTGTTCGCAAACCGAACGGAAAGTGGCGTCTGGTTCATGCTTATAACA
AGCTGAACAGCGCGACAGTGCCTGCGCAGACACCGATCCCGCGCAAGGACGTGTTGCTCAACAACATGGCCGGCTGCATGCTGTACAGCGCGCTGGACCT
GGTGGACGGATACTACCAGATCCTTATGCGCGGTGGCG