Description :
From Genome Similarity Track
Location :
contig_39:160130- 162041
Transcript NameFunction/comments
g6923.t1heat shock 70 kDa protein, mitochondrial precursor

Sequence
1911 bases(100 bases per row)
AACTCGGCGTCGTGCACGTTCTCGTCCTTGTTGTCGTCGCTGGCAGCGCCCTCGCCCTGCTGCGACTTGTAGACGGCCTCGCCGATCTTCATGGACATCT
TCTGCACCTCCTCCAGAGCGGCCTTGATCTCCTCCGTGTTGTCGGTCTCCGACTTGGTCCGCAGGTCAGCCAGAGCGGCCTTGACCTTCTCGAGGGTCTC
GGCGTCGATCTTGTCCGTGCTCCTTCAGGGTCTTCTCCGTCGTGTACAGGGTCGAGTCGGCGTCGTTCTTGGCCTCGATCAGCTCCTTGCGCTCCAGGTC
AGCGGCGGCGTTGGCCTCAGCGTCGGCAACCATCTTCTCGATCTCCGACTCCGACAGACCGCCACTCGACTGGATCACAATGTTCTGCTCCTTGCCCGTG
GCCTTGTCGCGGGCGCCCACGTTCACGATTCCGTTGGCGTCAATGTCGAAGCTCACCTCAATCTGAGGCACGCCACGCGGGGCAGGCGGGATGCCCACCA
GGTCGAAGTTGCCCAGCAGCTTGTTGTCAGTAGCCATCTCACGCTCGCCCTGCAGCACCTTGATGCCCACCTGCGTCTGCGAGTCAGCAGCCGTCGAGAA
CACCTGCGACTTCTTCGTGGGGATCGTCGTGTTACGCGGGATCAGCTTGGTGAACACACCGCCCAGGGTCTCAATACCCAGGGACAGCGGGGTCACATCC
AGCAGCAGAATGTCCTTCACGTCACCGCGCAGCACACCACCCTGGATGGCAGCGCCCATGGCCACGACCTCATCGGGGTTGACACCCTTCGAGGGCTTCT
TGCCGAAGAACTCCTCCACGGTCGTCTGCACCTTGGGCATACGCGACATACCGCCAACAAGGATGACCTCGTTGATCTCACTCTTGTCCAGGCCAGCGTC
CTTGACGCACTTCTTGCACGGGCCCATGGTGCGCTCGATCAGCTTGCCGACCAGCTGCTCGAAGGTGGCGCGCGTGATCTTCATGTTCAAGTGCTTGGGG
CCGGTGGCGTCGGCCGTGATGAAGGGCAGGCTGATGTCAGTCTGGGCCAGACCGTCGAGCTCGCGCTTGGCCTTCTCCGCGGCCTCACGCAGACGCTGCA
TGGCGAGGTTGTCGCCCGACAGGTCGATGCTGGACTCCTTCTTGAACTCGTCCACGAGGTAACGCAGGAGCTCCTCGTCGAAGTCCTCGCCGCCGAGCAG
CGTGTCGCCGTTGGTGGACTTGACCTCGAACACGCCGCCCGAGATCTCCAGGATCGACACATCGAAGGTACCGCCACCCAGGTCGAAGACGGCGATGACC
TTGCCGTCGGCCTTGTCCATGCCGTAGGCCAGGGCAGCGGCCGTGGGCTCATTGATGATACGGAGCACGTCCAGACCGGCGATCTTGCCGGCGTCCTTGG
TGGCCTGACGCTGCGAGTCGTTGAAGTAGGCCGGCACGGTGACGACGGCCTGGGTGATGGGCTTGCCCAGGAAGCCGTCGGCGGTCTCCTTCATCTTGGT
GAGTACCATGGAGCCGATCTGCGAGGGCGAGTACTTCTTGCCCTTGGCCTCGACCCACGCGTCCTTGCCGTTGTTGCCCTTGACGATCTTGTACGAGACC
ACCTTGGACACCTCCTGCGTCTCCTTGTCCTCGAACTTGCGGCCAATCAGGCGCTTGACGGCGTAGAACGTGTTCTCCGGGTTCGTCACGGCCTGGCGCT
TAGCGGGCATACCCACGAGGCGCTCGTCGTTGTCCAGAATGGCCACGACCGACGGCGTCGTGCGCGCGCCCTCTGAGTTCTCGATCACACGCGCGGCTTT
GCCCTCCATGACGGCCACGCACGAGTTGGTCGTGCCCAGGTCGATGCCGATGACCTCCGGAGCCGGCGGCGGCCGAGAACATGCGCTTGGCAGCCGCCGT
GGGGCGGGAGA